Plaanid puhkusele minna? Võta endale majutus AirBnb kaudu ja saad 37€ kontoraha Tee konto Sulge
Facebook Like

Ökoloogia konspekt (0)

1 Hindamata
Punktid

Esitatud küsimused

  • Kust algab süntees ja kus see lõppeb ?
  • Mitu aminohapet kodeeritakse ?
  • Milline on RNA vastavus sellele harule ?
  • Milline alleel on dominantne ?
  • Keskkonnaga Mis mõjutab liigi eksisteerimist konkreetses kohas ?
  • Milliseid ressursse kasutatakse ?
  • Mida tähendab ekstreemne /karm/soodne keskkond ?
  • Mis ohud sellega kaasnevad ?
  • Mis roll on mõju kestusel ?
  • Mis roll on mõju toimumise ajal ?
  • Milliseid muutused esinevad taimedel, millised loomadel ?
  • Milliseid ebasoodsaid tingimusi on vaja üle elada ?
  • Milliseid strateegiaid kasutavad taimed ?
  • Millest sõltub ?
  • Millest sõltub fotosünteesi intensiivsus ?
  • Mis mõjutab toitainete kättesaadavust ?
  • Millises pinnases haruneb juurestik rohkem ?
  • Miks on liigil just selline leviku areaal ?
  • Mis tegurid takistavad liigil mujale levimist ?
  • Miks on ühes piirkonnas rohkem endeemseid liike kui teises ?
  • Kus neid leidub ?
  • Kui palju ühe liigi isendeid saab piiratud territooriumil koos eksisteerida ?
  • Miks pole mõistlik kogu riigi pindala kasutada ?
  • Mis on selle plaani probleemid ?
  • Mis on selle plaani probleemid ?
  • Mida tarbida, kas mujal on parem ?
  • Kuidas aru saada, millises suktsessioonilises staadiumis on jälgitav kooslus ?
  • Milline on koosluse üldmulje ?
  • Milline taimede kasvustrateegia on valdav ?
 
Säutsu twitteris
Ökoloogia õppematerjal
Mõisted
Ökoloogia: Teadus, mis uurib organismide ja keskkonna vahelisi suhteid.
Biosfäär : globaalne kõigi ökosüsteemide kogum,
Maa elusosa – suletud ja isereguleeruv süsteem.
Ökosüsteem : Biosfääri elementaarosa, milles üks biotsönoos (eluskooslus) koos sellele omase biotoobiga (elu- või kasvupaigaga) moodustab mingil piiritletaval alal aineringe kaudu reguleeruva süsteemi.
Bioom : struktuuri ja funktsiooni poolest sarnaste ökosüsteemide kogumid Maal. Maismaa põhibioome 5, veebioome 2. Biotsönoos ( kooslus ): Mingit elu- või kasvupaika asustavate populatsioonide kogum. Floora ( taimestik ): mingil alal kasvavate taimede kogum, mis on kujunenud ajalooliselt või esinenud mingil paleontoloogilisel ajajärgul.
Fauna ( loomastik ): mingil alal kasvavate loomade kogum, mis on kujunenud ajalooliselt või esinenud mingil paleontoloogilisel ajajärgul.
Biodiversiteet ( elurikkus ): mingi ökosüsteemi taksonoomiliste üksuste mitmekesisus (geneetiline, liigiline ja ökosüsteemide mitmekesisus), mis on Maal ebaühtlaselt jaotunud ning koguneb „tulipunktideks“ (biodiversity hot-spot).
Ökoloogiline nišš: piirkond, kus organism saab edukalt paljuneda n-mõõtmelises hüperruumis, mille dimensioonideks on olulised ökoloogilised faktorid (G.E. Hutchinson).
Populatsioon : sama liigi isendite kogum, kes elavad ja interakteeruvad samas elupaigas ja nišis. Metapopulatsioon koosneb rändavate või levivate isendite populatsioonidest, mille kaudu need populatsioonid on seotud ja moodustavad süsteemi.
Ökoloogia harud
Autökoloogia on ökoloogia haru, mis tegeleb organismide keskkonnanõudluste ja keskkonna-suhete uurimise ja kirjeldamisega.
Demökoloogia ehk populatsiooniökoloogia on ökoloogia haru, mis uurib organismide populatsioone ja nende keskkonnaoludest johtuvat dünaamikat.
Sünökoloogia on ökoloogia haru, mis tegeleb liikidevaheliste suhetega ökosüsteemides, organismide mitmeliigiliste koosluste (ehk biotsönooside) ja nende dünaamikaga, liikide kooseksisteerimise mehhanismidega, koosluste keskkonnasuhetega.
Ökofüsioloogia on bioloogias teadus organismide (või üldisemalt biosüsteemide) talitlustest seoses keskkonnatingimustega. Ta on ökoloogia ja füsioloogia piiriteadus. Ökofüsioloogia keskseks valdkonnaks on organismide adaptatsioonide uurimine .
Taimeökoloogiahõlmab taimekoosluste ja taimeliikide ökoloogia uuringuid , käsitledes nende seoseid abiootilise keskkonnaga, samuti interaktsioone teiste organismidega erinevates ajamastaapides.
Loomaökoloogia ehk zooökoloogia on teadus, mis uurib loomade (üksikisendite ja populatsioonide) ajalooliselt kujunenud vastastikuseid suhteid ja keskkonnaseoseid. Loomaökoloogia tähtsamad harud on toitumis - ja sigimisökoloogia.
Rakendusökoloogia on ökoloogia valdkond , mis tegeleb ökosüsteemide majandamisel ja ökotehnoloogias esilekerkivate teaduslike probleemidega.
Makroökoloogia on ökoloogia valdkond, mis tegeleb suureskaalaliste ökoloogiliste protsesside uurimisega.
Organisatsioonitasemed
Geen, Rakk , Kude, Organ, Organism/ isend , Populatsioon, Kooslus, Ökosüsteem, Bioom, Biosfäär
Mõisteid
DNA: Desoksüribonukleiinhape, sisaldab organismi kogu pärilikku informatsiooni.
Kromosoom : DNA molekul , mis kannab geene.
Geen: kromosoomi kindlas lookuses paiknev pärilikkustegur, mis määrab otse või kaudselt (koostoimes teiste geenidega ) ühe või mitme tunnuse arengu.
Genoom : kõigi geenide kogum ühes liigiomases kromosoomikomplektis; iseloomulik kromosoomide arv ja –tüüp, DNA kogus ja nukleotiidjärjestuse tüübid, geenide arv ja vastastikune paiknemine .
Alleel : geeni üks variantidest; dominantne või retsessiivne
Lookus: piirkond kromosoomis, kus paikneb mingi geen
Dominantne alleel: alleel, mille poolt määratud tunnus alati avaldub (suurtähega, A).
Retsessiivne alleel: alleel, mille poolt määratud tunnus avaldub vaid dominantse alleeli puudumisel (väiketähega, a).
Homosügootsus : homoloogiliste kromosoomide samades piirkondades on ühe geeni ühesugused alleelid (AA, aa).
Heterosügootsus: homoloogiliste kromosoomide samas piirkonnas on ühe geeni erinevad alleelid (Aa).
Genotüüp : organismi kõik pärilikkustegurid (geneetiline koostis)
Fenotüüp : organismi kõik tunnused (välimus, funktsioneerimine)
DNA
Enamike elusorganismide pärilikku informatsiooni säilitav aine, koosneb desoksüriboosist, lämmastialustest ja fosforhappe jääkidest.
Puhas DNA on happeline, toatemperatuuril tahke, suhteliselt pehme, värvitu või õrnalt violetne, vees hästi lahustuv makromolekul.
DNA lämmastikalusteks on adeniin (A), guaniin (G), tsütosiin (C) ja tümiin (T).
DNA moodustab kahe komplementaarse ahela kujul kaksikheeliksi, mis DNA kopeerimiseks osaliselt lahti keerdub.
Raku jagunemise eel kahekordistub DNA hulk rakus ja keerdub histoonide ümber tihedalt kokku moodustades kromosoomid .
RNA
Ribonukleiinhape – bioloogiline üheahelaline makromolekul, mis osaleb geenide kodeerimises, dekodeerimises, geenide regulatsioonis ja ekspressioonis. ◦ mRNA: informatsiooni-RNA kannab DNA-lt valgusünteesiks vajaliku informatsiooni tuumast välja ribosoomi; ◦ tRNA: transport-RNA kannab aminohapped ribosoomi, kus geneetilise koodi alusel lisatakse need sünteesitavasse valguahelasse ◦ rRNA: ribosomaalne-RNA moodustab põhilise osa ribosoomidest ning viivad läbi valgusünteesi.
Lämmastikalustest sisaldab adeniini (A), tsütosiini (C), guaniini (G) ja uratsiili (U).
Erinevalt DNA-st on enamasti üheahelaline ja sisaldab riboosi.
Lämmastikalused
DNA ja RNA monomeeride nimetused:
Lämmastikalus Monomeer Tähis DNA RNA Valem
Adeniin Adenosiinfosfaat A X X C5H5N5
Guaniin Guanofosfaat G X X C5H5N5O
Tsütosiin Tsütidiinfosfaat C X X C4H5N3O
Tümiin Tümiinfosfaat T X - C5H6N2O2
Uratsiil Uridiinfosfaat U - X C4H4N2O2
Geneetiline kood
Vastavus RNA koodonite ja valke moodustavate aminohapete vahel, mille abil luuakse valke.
Geneetiline kood võimaldab DNA molekulidelt ümber kirjutatud geneetilise info tõlkida RNA molekulidele, mille järgi sünteesitakse valkude molekulid.
64 koodile vastab 20 aminohapet
Startkoodonid: AUG (UUG, CUG)
Stoppkoodonid: UGA, UAA, UAG
DNA kopeerimine
1) Lühike oligopeptiid sünteesitakse järgmisest RNA järjestusest:
5' GACUAUGCUCAUAUUGGUCCUUUGACAAG
Kust algab süntees ja kus see lõppeb? Mitu aminohapet kodeeritakse ?
2) Otse kopeeritav haru DNA kaksikheeliksist sisaldab järgnevust:
(5')CTTAACACCCCTGACTTCGCGCCGTCG
Milline on RNA vastavus sellele harule? Kas teise haru RNA vastavus on sama?
Geen
Geen mõjutab ühe või mitme tunnuse avaldumist .
Tunnus võib olla nähtav (naha värv, jäsemete arv) või väliselt eristamatu (veregrupp).
Geen võib avalduda juba sündides või elu jooksul või jääda passiivseks.
Äädikakärbse genoom sisaldab 139,5 mlj lämmastikaluse paari ning koosneb ca 15682 geenist, mis jaotub X,Y ja 3 autosoomi vahel.
Inimese genoomis arvatavasti 3,09 mlr lämmastikaluse paari, ca 20 000 valke kodeerivat geeni
Muutlikus
Sama liigi isendite võime üksteisest erineda
◦ Mittepärilik (modifikatsiooniline muutlikkus): geenide ja keskkonna koosmõjul, konkreetsed tunnused ei pärandu.
◦ Pärilik muutlikkus ◦ Mutatiivne (geen-, kromosoom-, genoommutatsioon ) ◦ Kombinatiivne (mittehomoloogiline, homoloogiline)
Kombinatiivne muutlikkus:
◦ Päriliku muutlikkuse teisene vorm
◦ Omab 3 tasandit ( ristsiire meioosi 1. profaasis , kromosoomide sõltumatu lahknemine 1. anafaasis, genoomide ühinemine viljastumisel)
Otseses seoses paljunemisviisiga (puudub vegetatiivsel paljunemisel, eoselisel minimaalselt, sugulisel maksimaalselt)
Mendeli seadused
Mendeli esimene seadus (ühtlikuse seadus) – homosügootide omavahelisel ristamisel on moodustunud esimene järglaspõlvkond geno- ja fenotüübiliselt ühtne.
AA X aa (homosügoodid)
A a ( sugurakud )
F1 Aa Aa Aa Aa ( heterosügoot )
Mendeli teine e. lahknemisseadus – heterosügootide omavahelisel ristamisel toimub järglaspõlvkonnas lahknemine. Fenotüübiliselt suhtes 3:1 või 1:2:1 ja genotüübilises suhtes 1:2:1
Aa X Aa (heterosügoodid)
AA, Aa, Aa, aa (F1)
Mendeli kolmas seadus – di(polü)hübriidsel ristamisel moodustuvad F2 põlvkonnas vanemate tunnuste kõikvõimalikud kombinatsioonid. Kusjuures ühe alleelipaari lahknemine ei mõjuta teise alleelipaari lahknemist. NB! Geenid peavad asuma eri kromosoomides.
Erandid
Intermediaarsus e. tunnuste vahepealne avaldumine (jalapa imelill)
P Punased kroonlehed X Valged kroonlehed
F1 Roosad kroonlehed
P Roosad kroonlehed X Roosad kroonlehed
F2 1 valge, 2 osa roosasid, 1 osa punaseid. (retsesiivne alleel mõjutab dominantse alleeli avaldumist) must kukk + valge kana = hallid tibud, lokkis juuksed + sirged juuksed = lainelised juuksed.
Kodominantsus e. üheaegselt avalduvad mõlema vanema tunnused.
P Must naarits X Valge naarits
F1 Kirjud naaritsad
F2 1 osa musti, 2 osa kirjusid, 1 osa valgeid
NB! Teatud geenikombinatsioonid põhjustavad organismi varast hukkumist.
Sümbolid
P – parents
F – filia, filialis
X – ristamine
F1, F2, F3 – põlvkonnad
Homosügoot – AA, aa
Heterosügoot – Aa
Ülesandeid
1. Hobuste puhul on punakaspruun karvavärv retsessiivne tähnilise karva suhtes. Kui heterosügootne tähniline isane paaritub punakaspruuni emasega, siis milline on genotüübiline ja fenotüübiline lahknemine järglastel?
2. Lillhernel domineerib punane õite värvus valgete üle. Missuguste õitega on F1 taimed, mis saadakse sordipuhaste punaste ja valgete lillherneste ristamisel? Milliste taimedega tuleks ristata F1 isendeid, et saada F2 põlvkonnas pooled punased ja pooled valged lillherned? 3. Teatud taimedel lilla x lilla ja lilla x sinine annavad siniseid ja lillasid järglasi, kuid sinine x sinine vaid siniseid järglasi. ◦ Mida ütleb see siniste ja lillade taimede genotüübi kohta? ◦ Milline alleel on dominantne?
4. Taimeliigi puhul on kõrge dominantne ja madal retsessiivne tunnus, samuti on dominantne oranz kroonlehtede värv ja retsesiivne on valge. Kasuta tähiseid K ja k kasvu kohta ning F ja f kroonlehtede kohta. Homosügootne valge kõrge lill ristatakse mõlema tunnuse osas heterosügootse lillega . Kirjuta mõlema vanema genotüübid ja F1 järglased
Kromosoomide arv
Kanep – 20
Uba – 22
Riis – 24
Apelsin – 18/27/36
Vihmauss – 36
Kass – 38
Nisu - 42
Inimene – 46
Kartul , tubakas , jänes , gorilla – 48
Elevant – 56
Tšintšilla – 64
Kana, koer – 78
Suhkruroog – 80
Võtmehein, bataat – 90
Põldosi – 216
Maokeel – 1260
Polüploidsus
Autopolüploidsus – kui tavapärane kromsoomide komplekt mitmekordistub:
◦ 2 diploidset gameeti ühinevad
◦ haploidne ja diploidne gameet ühinevad
Kaer , kohvipuu , õunapuu , banaan , suhkruroog, tšilli
Allopolüploidsus – kahe diploidse liigi hübriidi kromosoomide mitmekordistumine
◦ Liik X(A,A) ja liik Y(B,B) annavad F1 põlvkonnas järglased (A,A,B,B)
◦ Oluline roll uute liikide tekkimisel
Polüploidsetel isenditel sageli suuremad lehed, õied või viljad . Polüploidsus esineb looduslikult, kuid saab esile kutsuda kolhitsiiniga. Haplpoidsete ja triploidsete taimede viljad on tavaliselt steriilsed (seemnetud).
Steriilsed taimed
Hübriidide loomisel võivad tekkida steriilsed järglased (vanemate kromosoomide arv on erinev), selle ületamiseks kahekordistatakse kromosoomistik ning järglased muutuvad viljakaks.
Steriilsust võib sihilikult esile kutsuda populatsiooni kontrollimiseks vältimaks invasiivsuse teket. ◦ Ristatakse diploidne ja tetraploidne isend
Steriilsust kutsutakse esile seemnetute viljade tootmiseks (arbuus, banaan, pomelo)
Polüploidsed taimed võivad olla suuremad ja saagikamad ning sageli ka haiguskindlamad, kuid geneetilise sobimatuse korral nõrgemad ja steriilsed.
Mutatsioonid
Kiire ja äärmuslik pärilik muutus geenis, mis ei tulene rekombineerumisest. Võivad olla looduslikud või esile kutsutud ning ilmnevad kas kromosoomi, geeni, genoomi, molekuli või tsütoplasma tasandil. Mutatsioon võib ka olla numbriline - geenide või kromosoomide ebatüüpiline hulk. Kasvumutatsioonid avalduvad suvalisel hetkel taime kasvamise jooksul, nisu puhul põhjustab kääbuskasvu. Mutatsiooni avaldumine sõltub, kas tegu on dominantse või retsesiivse vormiga ning see kandub edasi järglastele. Somaatilised mutatsioonid esinevad keharakkudes, ei kandu järglastele edasi gameetide kaudu. Fenotüübi muutused sõltuvad mitmetest teguritest, võib tekitada kudede vohamist, rakkude ainevahetuse muutust. Esineb vegetatiivselt paljunevatel organismidel, kasutatakse iluaianduses ja puuviljade kasvatamisel (õunad, naba-apelsinid). Mutatsioonid on kas spontaansed või indutseeritud.
Mutageenid
Bioloogilised: ◦ Viirused ◦ Alkaloidid ◦ Mükotoksiinid ◦ Juhuslikud vead DNAga toimuvates protsessides
Keemilised: ◦ Tubakasuits ◦ Ravimid ◦ Olmekemikaalid ◦ Toidulisandid ◦ Fenool ◦ Keemiarelvad
Füüsikalised: ◦ Radioaktiivne kiirgus ◦ Röntgenkiirgus ◦ UV-kiirgus ◦ Ülitugev elektromagnetkiirgus
Kromosoomi mutatsioonid
Muutub mõne kromosoomi struktuur või geeniline koostis. Ühe kromosoomi piires: ◦ Deletsioon – kromosoomi lõik kaotatakse ära ◦ Duplikatsioon – kromosoomi lõik kahekordistub ◦ Inversioon – kromosoomi lõik muudab asukohta . Kahe kromosoomi vahel: ◦ Insertsioon – lõik ühest kromosoomist läheb teise kromosoomi üle ◦ Translokatsioon – lõigud kromosoomide vahel lähevad vahetusse
Geenmutatsioon
Mutatsioon toimub vaid molekulaartasandil, DNA-s muutub tavaliselt üks, harvem mitu nukleotiidi.
Punktmutatsioon on tavaliselt põhjustatud kemikaalidest või DNA replikatsiooni häirest.: ◦ Puriinide asendumine (tsütosiin↔tümiin) ◦ Pürimidiinide asendumine (adeniin ↔guaniin) ◦ Puriin ↔pürimidiin
Kui asendunud lämmastikalus kodeerib sama aminohapet, on tegu vaikiva mutatsiooniga.
Kui asendunud koodon lõpetab valgusünteesi, on tegu nonsenssmutatsiooniga.
Kui asendunud koodon kodeerib teist aminohapet, on tegu missensse mutatsiooniga.
Geenmutatsioonide mõju tunnusele
Mutatsioon ei avaldu
Mutatsioon avaldub: ◦ Tunnus tugevneb ◦ Tunnus nõrgeneb ◦ Tunnus kaob ◦ Tekib uus tunnus
≈90% mutatsioonidest on nõrgalt kahjulikud
≈ 5% mutatsioonidel on surmav toime
≈ 5% mutatsioonidest on neutraalsed
≈1% mutatsioonidest on kasulikud
Genoommutatsioonid
Muutub isendi terve karüotüüp kas mõne kromosoomi lisamise või kadumisega, võimalik on ka kromosoomide liitumine või mitmeks jagunemine.
13. kromosoomi trisoomia : Patau sündroom (väärarengud)
18. kromosoomi trisoomia: Edwardsi sündroom (organite väärarengud)
21. kromosoomi trisoomia: Downi sündroom
X0: Turneri sündroom (jäme kael , tervisehäired)
XXY: Klienefelteri sündroom ( steriilsus )
Organismide kaitsevõimalused kahjulike mutatsioonide eest
Reparatsioon – DNA vigade leidmine ja kõrvaldamine
Diploidsus – geenialleelid on keharakkudes kahes korduses
Regulaatorgeenide mõju – ei luba mutanteerunud alleele avalduma.
Polügeensus – üks tunnus määratakse paljude geenide poolt(seda loetakse suurimaks bioloogiliseks saavutuseks organismidel). Polügeensed tunnused on tavaliselt väga elutähtsad (kasv, kaal, vaimsed võimed).
Haplofaasi lühenemine elutsüklis(haplofaasis avalduvad kõik mutatsioonid). Bakteritel on 100% haplofaas, imetajatel on haplofaasis sugurakud.
Teatud mutantide steriilsus või eluvõimetus.
Mutantide alakohasus võrreldes normaalsete isenditega.
Sordiaretus
Teadus taime omaduste muutmisest kujundamaks soovitud omadusi ◦ Kindlate omadustega taimede valik ◦ Kontrollitud ristamine
Omadused, mida enamasti parandada tahetakse: ◦ Kvaliteedi ja saagikuse suurendamine , varane valmimine ◦ Keskkonnamõjude suurem taluvus ( soolsus , põud, kuumus) ◦ Vastupidavus viirustele, seenhaigustele ja bakteritele ◦ Vastupidavus herbitsiididele; konkurentsivõime umbrohtudega ◦ Visuaalselt huvitavamaks muutmine
Ristamine
Molekulaarne aretus: In vitro, Koekultuurid
Kultuurtaimede sortide ja hübriidide loomine ja parandamine.
Sordiaretus algab aretuskava koostamise ja lähtematerjali muretsemisega.
Sordiaretuse võtted on ◦ hübriidimine ◦ indutseeritud mutagenees ◦ heteroosi kasutamine ◦ kromosoomi ja geeni struktuuri muutmine ◦ geeni siirdamine ◦ protoplasmade liitmine ◦ kromosoomi lisamine ja asendamine.
GMO
Geneetiliselt muundatud organism – kunstlikult geenide manipulatsioonide teel muudetud/parandatud taimesort või loomatõug: ◦ Geeniosa kunstlik ülekandmine ühelt organismilt teisele, “genetic engineering” ◦ Uue osaga organismi nimetatakse transgeenseks ◦ Võimaldab kombineerida väga kaugete liikide geene
Esimene GM loom oli hiir . Esimene GM taim oli tubakas, et herbitsiididele immuunne olla. Levinuimad GMO-d on herbitsiidikindlad soja-, rapsi- ja maisisordid ning putukamürke sünteesivad maisi- ja puuvillasordid.
GMO
80% loodud GMO-dest on herbitsiidele vastu pidamiseks
90% kasvatatud maisist Ht ja/või Bt
95% suhkrupeedist Ht
Muundatud taimed võivad pärilikkusainet edasi anda nii liigi sees kui ka eri liikide vahel. GMO-dega võivad kaasneda keskkonna-, tervise- ning sotsiaalmajanduslikud riskid .
Rakk
Kõige väiksem isetoimiv elusorganismi ehituslik ja talituslik osa. Rakk võib olla päristuumne (looma, taime, seene rakud ) või eeltuumne ( bakter ). Päristuumne rakk sisaldab tuuma, tsütoplasmat ja selles leiduvaid organelle. Organism võib olla ainurakne, hulkrakne või koloniaalne. Hulkraksete organismide rakud on spetsialiseerunud täitmaks erinevaid ülesandeid, sarnased rakud moodustavad koe. Rakkude suurus muutub elu jooksul. Inimese organismis on ~200 erinevat tüüpi rakku. Kõige kiiremini uuenevad naha, vere ja mao epiteelkoe rakud. Paljud rakud peale diferentseerumist enam ei jagune. Taimerakkude peamiseks erinevuseks on plastiidide esinemine, mis võimaldab neil olla autotroofid – toota ise esmast orgaanilist ainet ( fotosüntees ).
Raku ehitus
Tuum (päristuumsetel) ◦ Tuumake
Tsütoplasma ◦ Endoplasmaatiline retiikulum (ER) ◦ Mitokondrid ◦ Golgi kompleksPlastiidid (ainult taimedel) ◦ LüsosoomidRibosoomid ◦ Vesiikulid ◦ Tsentrosoom (ainult loomadel)
Vakuool (ainult taimedel)
Rakumembraan
Rakukest (seentel, taimedel)
Vibur (bakteritel, väiksematel eukarüootidel)
Taimerakkude kuju
Parenhüümsed: Ehk isodiameetriline Igas mõõtmes enamvähem võrdse läbimõõduga Enamike kudede rakud
Prosenhüümsed: Väljavenitatud rakk Pikkus on mitu korda suurem, kui laius Ühe raku pikkus võib ulatuda kuni 25 cm Juhtkudede rakud
Rakukest
Koosneb kahest põhiosast – primaarne rakukest ja sekundaarne rakukest Primaarne rakukest: ◦ Kesta osa, mis tekib raku pooldumisel ◦ Tekib: rakuplaat -> vahelamell -> primaarne rakukest ◦ Koosneb põhiliselt pektiinainetest
Rakukest
Sekundaarne (teisene) rakukest ◦ Kesta osa, mis tekib uute kihtide ladestumisel primaarsele kestale ◦ Tekib: tselluloosi molekulid ->mitsellid->mikrofibrillid->fibrillid
Ülesanneteks: ◦ Kaitseb protoplasti ◦ Annab rakule püsiva kuju ◦ Kogumina on toes kudedele
Poorid – kohad rakukestas, kus vaid primaarne rakukest ning kesta läbivad tsütoplasma kanalid
Rakukesta tugevnemine
Puitumine: ◦ Protsess, kui raku kesta, maatriksisse ja vahelamelli ladestub ligniin ◦ Kest kaotab elastsuse, muutub jäigaks ja tugevaks, läbilaskvus väheneb ◦ Toimub ksüleemis
Korgistumine ◦ Rakukesta sisepinnale ladestub suberiin ◦ Protoplast sureb , sest suberiin ei lase läbi õhku ega vett ◦ Toimub korgikoes
Rakukesta tugevnemine
Puitumisel ladestub ligniin rakukesta ja vahelamelli. Rakukestad muutuvad paksemaks, jäigemaks, läbilaskvus väheneb.
Korgistumisel ladestub kesta sisepinnale suberiin. Kestad ei muutu eriti paksemaks, läbilaskvus kaob, rakusisu hävineb.
Rakumembraanid
Õhukesed kilejad moodustised rakus, mis ◦ Moodustavad tsütoplasma ja organellide pinnakihi ◦ Jagavad tsütoplasma eraldatud osadeks ◦ Kujundavad tsütoplasma ja organellide sisestruktuuri ◦ Sisaldavad lisaks fosfolipiididele kolesterooli ja glükolipiide Plasmalemm – membraan , mis eraldab rakukesta tsütoplasmast Tonoplast – membraan, mis eraldab vakuooli tsütoplasmast Plasmodesm – rakukesta läbivad kanalid, mis ühendavad naaberrakkude tsütoplasmat.
Koosnevad fosfolipiididest ja valkudest.
Kahes kihis – keskel fosfolipiidid ( hüdrofoobne osa), kummalgi pool välisküljel valgu molekulid (hüdrofiilne osa), membraani sees erineva funktsiooniga valgud : transport, retseptor , ensüüm ;
Need membraanid on poolläbilaskvad – osa aineid läbivad membraane väga raskelt , teised väga kergelt, isegi kõrgema kontsentratsiooni suunas
Membraanid on nö iseparanevad – membraani rebenedes organiseeruvad fosfolipiidid automaatselt uuesti.
Ainete transport läbi membraanide
Hüdrofoobse vahekihi tõttu ei pääse polaarsed molekulid membraanist läbi – selleks on vaja eraldi transportvalke ◦ Perifeersed valgud , retseptorvalgud, transportvalgud , pinna antigeenid , millel on hüdrofiilsed ja hüdrofoobsed osad ◦ Transport on kas aktiivne või passiivne ◦ Iga molekuli transpordi jaoks on oma valk ◦ Kanalvalgud: ◦ Uniport : ainete saatmine ühelt poolt teisele poole ◦ Kotransport: kahe erineva aine transport kas samas suunas või vastassuunaliselt ◦ Kaalium - naatrium pumbad .
Taimeraku organellid
Tsütoplasma koostisesse kuuluvad:
Plastiidid – kloroplastid - fotosüntees
Mitokondrid – ATP süntees
Ribosoomid – valkude süntees
Golgi kompleks – valkude ja lipiidide modifitseerimine
Lüsosoomid – sisaldavad lagundavaid ensüüme
Endoplasmaatiline retiikulum – valkude ja lipiidide süntees
Plastiidid
 Proplastiidist võib saada kas  Leukoplast (värvusetu)  Kloroplast (roheline)  Kromoplast (oranž- kollakas -punakas)
Plastiidid võivad omavahel üle minna ühest teiseks, kõik plastiidid on topeltmembraaniga
Plastiidide ülesanded
Kloroplast: sisaldab klorofülli, mis annab rohelise värvuse; püüavad ja säilitavad valgusenergiat makroergiliste sidemete energiana (ATP); toimub fotosüntees – sünteesitakse esmast orgaanilist ainet; kloroplastidel on oma genoom ja ribosoomid
Kromoplast: sisaldab erinevaid pigmente, mis annavad kollase-oranži-punase värvuse; annavad värvuse õitele ja viljadele, meelitades kohale tolmendajad või seemnete levitajad
Leukoplast: värvusetu; ainete ladustamiseks ◦ Amüloplast: tärklise säilitamiseks ◦ Elaioplast: rasvade säilitamiseks ◦ Aleuronoplast: valkude säilitamiseks ja modifitseerimiseks
Leukoplast ja kromoplast
Leukoplast: leidub enamasti säilitusorganites (tärklis) ja seemnetes (valgud, õlid ), osaleb elutähtsates biosünteesi protsessides.
Kromoplast: leidub juurtes, viljades, õites ja ka lehtedes. Sisaldab erinevaid pigmente ( karotenoidid , ksantofüllid, flavonoidid jm). Võimaldavad vees lahustumatuid ühendeid säilitada muidu veerohketes organites .
Kloroplastid
Esinevad peamiselt põhikoe rakkudes, annavad taimedele rohelise värvuse, viivad läbi fotosünteesi.
Peale tuuma ja vakuooli ainukesed väikese suurendusega nähtavad organellid rakus.
Topeltmembraaniga: ◦ Välimine membraan hästi läbilaskev ◦ Sisemine membraan suure pinnaga, väga sopistunud, moodustab lisakompartmente: tülakoide ja graane.
Valgusreaktsioonid: tülakoidides
Pimedusreaktsioonid: stroomas
Kloroplast ja mitokonder
Ainukesed organellid, mis on topeltmembraaniga Sisemise membraani pindala tänu sopistustele väga suur Oma genoom (DNA ja RNA) ja ribosoomid Tegelevad energia muundamisega Hõlmavad suure osa raku mahust Tõenäoliselt tekkinud endosümbioosi teel Paljunevad raku jagunemisest sõltumatult
Mitokonder
Ühes rakus tavaliselt mitusada, suuremad organellid tuuma ja vakuoolide järel
Olemas kõigis eukarüootsetes rakkudes
Kuju varieerub niitjast ellipsioidini, väga plastilised ja kiire liikumisega
Topeltmembraaniga: ◦ sisemine membraan moodustab kristad ehk harjakesed ◦ Välimine membraan sisaldab palju transportvalku
Paljunevad jagunemise teel, mis toimub tuuma jagunemisest sõltumatult
Muundavad energia rakus kasutatavasse vormi, energia allikaks suhkrud, põhimõttelised lõppproduktid on CO2 ja NADH
Vakuool
Enamike taimerakkude suurim kompartment . Ühes rakus võib olla ka mitu vakuooli; Vakuool tekib noores taimerakus Golgi kompleksist pärinevate vesiikulite ühinemisel; Vakuoolil on palju funktsioone: ◦ säilitusorganell (nii toitainete kui jääkproduktide jaoks) ◦ sisaldab rakumahla – orgaaniliste ja anorgaaniliste ainete vesilahuslüsosoom , s.t. lagundav kompartment ◦ turgori reguleerimine ◦ vakuooli arvelt võib taimerakk oma mõõtmeid suurendada. Sellele eelneb rakukesta nõrgenemine teatud kohtadest .
Varuained taimes
Tärklis – tärkliseterad; peamiselt juurtes
Valk – aleurooniterad; peamiselt seemnetes ja idudes
Rasvõlid – õlitilgakesed; peamiselt seemnetes/viljades
Kaltsium taimedes
Kristallid koosnevad Ca-oksalaadist CaC2O4 ◦ Druusid ◦ Rafiidid ◦ Üksikud pulkkristallid
Vajalik hapete neutraliseerimiseks, spetsialiseerunud rakud teiste kudede vahel
Suurtes kogustes inimesele mürgine
Rafiidid ja druusid
Ribosoomid
Ülesandeks valkude süntees läbi transkriptsiooni Koosnevad kahest osast:
80% sisust ei kuvatud. Kogu dokumendi sisu näed kui laed faili alla
Vasakule Paremale
Ökoloogia konspekt #1 Ökoloogia konspekt #2 Ökoloogia konspekt #3 Ökoloogia konspekt #4 Ökoloogia konspekt #5 Ökoloogia konspekt #6 Ökoloogia konspekt #7 Ökoloogia konspekt #8 Ökoloogia konspekt #9 Ökoloogia konspekt #10 Ökoloogia konspekt #11 Ökoloogia konspekt #12 Ökoloogia konspekt #13 Ökoloogia konspekt #14 Ökoloogia konspekt #15 Ökoloogia konspekt #16 Ökoloogia konspekt #17 Ökoloogia konspekt #18 Ökoloogia konspekt #19 Ökoloogia konspekt #20 Ökoloogia konspekt #21 Ökoloogia konspekt #22 Ökoloogia konspekt #23 Ökoloogia konspekt #24 Ökoloogia konspekt #25 Ökoloogia konspekt #26 Ökoloogia konspekt #27 Ökoloogia konspekt #28 Ökoloogia konspekt #29 Ökoloogia konspekt #30 Ökoloogia konspekt #31 Ökoloogia konspekt #32 Ökoloogia konspekt #33 Ökoloogia konspekt #34 Ökoloogia konspekt #35 Ökoloogia konspekt #36 Ökoloogia konspekt #37
Punktid 10 punkti Autor soovib selle materjali allalaadimise eest saada 10 punkti.
Leheküljed ~ 37 lehte Lehekülgede arv dokumendis
Aeg2018-01-11 Kuupäev, millal dokument üles laeti
Allalaadimisi 8 laadimist Kokku alla laetud
Kommentaarid 0 arvamust Teiste kasutajate poolt lisatud kommentaarid
Autor MrsAnni Õppematerjali autor

Lisainfo

Kokkuvõttev konspekt üldiselt ökoloogiast.
Ökoloogia , konspekt , tasemed , kromosoom , juur , rakk , rakud , membraan , elund , mutatsioon , tolmutera , ökoloogia , rakukest

Kommentaarid (0)

Kommentaarid sellele materjalile puuduvad. Ole esimene ja kommenteeri


Sarnased materjalid

98
docx
Kogu keskkooli bioloogia konspekt
37
doc
Üldbioloogia konspekt-1-osa
83
pdf
Esimese nelja kursuse materjal
23
doc
Üldbioloogia konspekt
17
doc
Üldbioloogia eksami konspekt
17
docx
11 klassi bioloogia konspekt
150
docx
Bioloogia gümnaasiumi materjal 2013
16
doc
Ökoloogia konspekt



Faili allalaadimiseks, pead sisse logima
Kasutajanimi / Email
Parool

Unustasid parooli?

UUTELE LIITUJATELE KONTO MOBIILIGA AKTIVEERIMISEL +50 PUNKTI !
Pole kasutajat?

Tee tasuta konto

Sellel veebilehel kasutatakse küpsiseid. Kasutamist jätkates nõustute küpsiste ja veebilehe üldtingimustega Nõustun