Vajad kellegagi rääkida?
Küsi julgelt abi LasteAbi
Mõistete sõnaraamat
Ukraina abi Ukraina kaitse vajab abi. Tee annetus täna! Aita Ukrainat Sulge
Add link
140 - õõnesplokk. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 190-õõnesplokk. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 240-õõnesplokk. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 Fassaadikivid. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 Murtud kivi.
1407 - 1436 ehitasid nn. brigitiinid Tallinna lähedale suurima Eesti kloostri - Pirita kloostri Eesti maarahvas uut usku täielikult omaks ei võtnud ja kujunes omamoodi segu risti ja maausu vahel – rahvausk, mis kujundas tänaseks peamised maarahvakalendri tähtpäevad ja isikunimed. 1517.a. alustas Martin Luther Saksamaal reformatsiooni ehk usupuhastust.
140 - 145°C 7. LD 50 33487 mg/kg 8. Mürgisus, toksilisus 9. Vees lahustuvus, milles lahustub kui vees ei lahustu? Praktiliselt vees mittelahustuv 10. Olek toatemperatuuril - vedel 11. Värvus, elektrijuhtivus, tihedus tuhm kollane, ei juhi elektrit, 0.984 12. Kasutamine

140 - 240 mm jämedateks alates 260 mm.piikus kõigub 0,5m tavapäraselt 6 meetrini .lehtpuidus ümarmaterjalid on peened läbimõõduga 80 – 130 mm.keskmiselt 140-240 mm jämedad üle 260 mm.ümarmaterjali hulka arvestatakse hulka tm.ja tükiviisiliselt.
1406 - 1469) ja Domenico Veneziano (u 1400-1461). 15. sajandi lõpupoole oli Firenzes suurimaks kunstnikuks Sandro Botticcelli (u 1445- 1510). Ta oli esimesi kunstnikke, kes hakkas võtma oma tööde tegelaskujusid antiikmütoloogiast.
1401 - 1428) 1452-1529 paradiisit väljaajamine la jaconde(mona lisa)(louvre) fresko, renesanssi algustöö, sama kirku seintele giocondo oli Lisa abikaasa perekonnanimi, maalis ta ka pilte apostel peetruse elust.

1402 - 1404. Uurimismaterjalide põhjal võib väita, et magistraadi e. rae kooskäimise kohana oli väike kindlustüüpi ühekorruseline keldriga raekoda oma praegusel asukohal olemas juba 13.sajandi keskel.
1400 - 1500 ° C juures koos räniga – söödafosfaatide vastavates proportsioonides torureaktorisse, kuhu Magnesiaalne lubi - CaO · MgO (dolomiidi tootmine juhitakse ka fosfaadimaak.
1407 - 29. juunil tungivad pihkvalased vürst Konstantini ja Roman Sidorovi juhatusel üle Narva jõe Virumaale, rüüstavad palju külasid ja pöörduvad rikkaliku röövsaagiga tagasi.

140 - tähemärgi piirang suurendas ka veebiaadresside lühendajate, nt bit.ly ning sisuhostingute saitide, nt Twitpic kasutatavust, et muuta URL link lühemaks kui 140 tähemärki.
140 - ggggcaatctccaagaattatggaaagagttgttaggtaaaaataggga 188 |.||||||||||||||||||||||||||||||||||||||||||||||| EMBOSS_001 100 tgtggcaatctccaagaattatggaaagagttgttaggtaaaaataggga 149
140 - 150 g grillitud loomaliha 1 küpsekartul koos 2 supilusikatäie hapukoorega 1 klaasitäis aurutatud suvikõrvitsat või teisi köögivilju 1 näkileib võiga Vet, taimeteed

140 – Ehitus- ja remonditööde korraldamine kinnisvaraobjektil – on vaja korraldada kinnisvaraobjektil selle korrashoiu (füüsilise säilimise) tagamiseks.
14000 - 15500 marka Rajooniülem 1050 marka 2500 marka 2950 marka 6200 marka 9000- 10000 marka Kordnik 980 marka 2300 marka 2500 marka 5500 marka 7000 marka
140 - 150kraadi ja survel 15-16mBa see annab tiheduse kuni 1330kg/m3 Kasutatakse masinaehitusel, liugelaagrite ja hammasrataste valmistamiseks.

1400 - 1461 • uudne hele ja värvirõõmus koloriit, uurib valguseprobleeme, pildi ruum täpselt ja selgelt määratud arhitektuurilise tausta
1400 – 1500 cm³). HE luude leidmine on seotud 19. sajandi lõpust alanud inimese kaugemate eellaste jäänuseid süstemaatilise otsimisega.
14005 - 40 22 050A Lõikeriist: Sandvik CoroMill Plura R215.84-01500-BC43G Hoidja: Sandvik 392.14020-40 10 063 Terahoidja: Iscar MTSR 0021 H21

1407 - 1577. aastani, mil hävitati venelaste poolt (Liivi sõda). Pirita kloostri emakloostriks ja eeskujuks oli Vadstena klooster Rootsis.
140 - 150*C, kergelt vormitav 125-130*C juures Kasutamine: valmistatakse valguskindlat orgaanilist klaasi, kilet, läätsesid.
1404 - 1472. Ta oli itaallane ning tänapäeval kohtab teda iseloomustavat väljendit „universaalne mees“ vararenessansist.

1400 - 1474). Ta oli pärit Madalamaade vaimuelu ühest tähtsamast keskusest Cambrai`st, kus ta ka pikemat aega tegutses.
1409 ferrara – Firenze kirkikukogu (aluseks hilisematele unioonidele, nt Bresti unioonile) aga reaalsuseks see unioon ei saanud.
1401 - 1464 • Metafüüsika • Elu • Erinevalt Thomasest rõhutab ta erilist ja • Moseli äärest pärit sakslane.

1400 – reljeef kujutab Maarjat inglitega-see oli Eesti Rahva Muuseumi üks eksponaatidest. Pearuum on kaheksanurkne.
1400 – 1450 ºC-ni. Kütusetolmu põletamine kõrgel temperatuuril tagab intensiivse soojus- vahetuse koldekambris.
1400 - 1464 • Dramaatilised tunded • „Kristuse ristilt võtmine“- haaravalt traagilised miimika ja kehakeel.

1402 – 1409. Meat, Meat Products, and Seafoods, edited by F. Joo, S. T., R. Kauffman, B. C. Kim, and G. B. Park.
1403 - CPD-003 on väljastatud AS Teede Tehnokeskuse poolt ja kantud EV Keskkonnaministeeriumi registrisse.
140 - 141, 149, 265 Department of Communication, 263-264, 265-266 De-Scrambler, 293 Deubner, L., 351-

1402 - 1404 sai raekoda omale 2. korruse, 14. saj. 1 veerandil tehti sinna ka eesruuum ja tagakamber.
1400 - 1455) ● Munk (frate – it. vend), idealistliku, konservatiivse suuna kuulsaim esindaja.
140 - õõnesplokk 190-õõnesplokk 240-õõnesplokk Murtud kivi Murtud õõnesplokk Täisplokk

1400 - 1461) D. Veneziano piltide ruum on konstrueeritud nagu vaataja vastas asuv teatrilava.
140 - Milliseid tõstemehhanisme kasutatakse pukk-kraanadel? a) Lastivanker b) Eletritelfer
1406 - Pihkva vürstide Danilo ja Juri sõjakäik Liivimaale, Vastseliina ja Kirumpääni.

140 –  200 workers would pull the  stone upright perhaps using a  pulley.
1400 - 1482) ja ANDREA della ROBBIA (1435-1525) olid silmapaistvad maljoolikameistrid.
140 - õõnesplokk Koplekti kuuluvad rea-, pool-, sillus-, sarrus- ja nurgaplokk

1400 - 1464) ● Lõuna-Madalmaade koolkonna jõuliseim ja andekaim kunstnik.
1401 – 1424 töötas Firenze toomkiriku ristimiskabeli põhjauste loomisel.
1406 – Pihkva vürstide sõjakäik Liivimaale, Vastseliina ja Kirumpääni.

1409 – Pisas kutsuti kokku üldine kirikukogu, et valida ühine paavst.
1404 - linnavalitsuse hoone (Tln.-s 1404 gootikas + raeapteek 1422)
140 - aastane Suislepa õunasordi tüvepuu hävis 1970. aastatel.

1406 - 1469) ● Varasemates töödes naiivne ja pühalik joon.
140 - Milliseid tõstemehhanisme kasutatakse pukk-kraanadel?
140 - 146; http://www.eki.ee/keeleabi/artiklid2/kaubad.html

14001 järgi on põhimõtteliselt vastavuse seesmiseks vabatahtlik.
14020 - 40 20 070 Mõõteriist: digitaalne nihik 150/0,01
140 – 170 cm. • Pikkuseks on 3,3 kuni 3,6 meetrit.

140 - 160 bp 2-ahelaline DNA + histoonide oktameer.
1402 - Alumises paremas nurgas 04. Pühavaimu kirik.
140 - 141, 145, 153, 168 Winds code, 31-32, 34-35,

1400 - inkad olid vallutanud enamiku Andidest.
1407 - Pirita klooster birgitiinlaste poolt.

1404 – valmis Tallinna praegune raekoda.
140 on tolle aja ooperimuusika stiilis.
1400 ekr – Hetiidi riigi võimu tipp.

1407 - Pirita kloostri asutamine.
140 - 37 Hasmoneide kuningriik.
1400 - 1461) Domenico Veneziano.

1400 – 28 – 288,12 = 1083,88
1400 - 1500. Inkade kultuur.

1401 - 1391 eKr Thutmosis IV



Tulemused kuvatakse siia. Otsimiseks kirjuta üles lahtrisse(vähemalt 3 tähte pikk).
Leksikon põhineb AnnaAbi õppematerjalidel(Beta).

Andmebaas (kokku 683 873 mõistet) põhineb annaabi õppematerjalidel, seetõttu võib esineda vigu!
Aita AnnaAbit ja teata vigastest terminitest - iga kord võid teenida kuni 10 punkti.

Suvaline mõiste



Kirjelduse muutmiseks pead sisse logima
või
Kasutajanimi/Email
Parool

Unustasid parooli? | Tee tasuta konto


Registreeri ja saadame uutele kasutajatele
faili e-mailile TASUTA

Konto olemas? Logi sisse

Sellel veebilehel kasutatakse küpsiseid. Kasutamist jätkates nõustute küpsiste ja veebilehe üldtingimustega Nõustun