Sõnu seletav sõnaraamat
Mis veebilehti külastad? Anna Teada Sulge
Facebook Like
Küsitlus
140 - õõnesplokk. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 190-õõnesplokk. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 240-õõnesplokk. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 Fassaadikivid. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 Murtud kivi.
140 - 145°C 7. LD 50 33487 mg/kg 8. Mürgisus, toksilisus 9. Vees lahustuvus, milles lahustub kui vees ei lahustu? Praktiliselt vees mittelahustuv 10. Olek toatemperatuuril - vedel 11. Värvus, elektrijuhtivus, tihedus tuhm kollane, ei juhi elektrit, 0.984 12. Kasutamine
140 - 240 mm jämedateks alates 260 mm.piikus kõigub 0,5m tavapäraselt 6 meetrini .lehtpuidus ümarmaterjalid on peened läbimõõduga 80 – 130 mm.keskmiselt 140-240 mm jämedad üle 260 mm.ümarmaterjali hulka arvestatakse hulka tm.ja tükiviisiliselt.

1400 - 1500 ° C juures koos räniga – söödafosfaatide vastavates proportsioonides torureaktorisse, kuhu Magnesiaalne lubi - CaO · MgO (dolomiidi tootmine juhitakse ka fosfaadimaak.
140 - tähemärgi piirang suurendas ka veebiaadresside lühendajate, nt bit.ly ning sisuhostingute saitide, nt Twitpic kasutatavust, et muuta URL link lühemaks kui 140 tähemärki.
140 - ggggcaatctccaagaattatggaaagagttgttaggtaaaaataggga 188 |.||||||||||||||||||||||||||||||||||||||||||||||| EMBOSS_001 100 tgtggcaatctccaagaattatggaaagagttgttaggtaaaaataggga 149

140 - 150 g grillitud loomaliha 1 küpsekartul koos 2 supilusikatäie hapukoorega 1 klaasitäis aurutatud suvikõrvitsat või teisi köögivilju 1 näkileib võiga Vet, taimeteed
140 – Ehitus- ja remonditööde korraldamine kinnisvaraobjektil – on vaja korraldada kinnisvaraobjektil selle korrashoiu (füüsilise säilimise) tagamiseks.
140 - 150kraadi ja survel 15-16mBa see annab tiheduse kuni 1330kg/m3 Kasutatakse masinaehitusel, liugelaagrite ja hammasrataste valmistamiseks.

1400 - 1461 • uudne hele ja värvirõõmus koloriit, uurib valguseprobleeme, pildi ruum täpselt ja selgelt määratud arhitektuurilise tausta
1400 – 1500 cm³). HE luude leidmine on seotud 19. sajandi lõpust alanud inimese kaugemate eellaste jäänuseid süstemaatilise otsimisega.
140 - 150*C, kergelt vormitav 125-130*C juures Kasutamine: valmistatakse valguskindlat orgaanilist klaasi, kilet, läätsesid.

1400 - 1464 • Dramaatilised tunded • „Kristuse ristilt võtmine“- haaravalt traagilised miimika ja kehakeel.
140 - 141, 149, 265 Department of Communication, 263-264, 265-266 De-Scrambler, 293 Deubner, L., 351-
1400 - 1455) ● Munk (frate – it. vend), idealistliku, konservatiivse suuna kuulsaim esindaja.

140 - õõnesplokk 190-õõnesplokk 240-õõnesplokk Murtud kivi Murtud õõnesplokk Täisplokk
1400 - 1461) D. Veneziano piltide ruum on konstrueeritud nagu vaataja vastas asuv teatrilava.
140 - Milliseid tõstemehhanisme kasutatakse pukk-kraanadel? a) Lastivanker b) Eletritelfer

140 –  200 workers would pull the  stone upright perhaps using a  pulley.
1400 - 1482) ja ANDREA della ROBBIA (1435-1525) olid silmapaistvad maljoolikameistrid.
140 - õõnesplokk Koplekti kuuluvad rea-, pool-, sillus-, sarrus- ja nurgaplokk

140 - aastane Suislepa õunasordi tüvepuu hävis 1970. aastatel.
140 - Milliseid tõstemehhanisme kasutatakse pukk-kraanadel?
140 - 146; http://www.eki.ee/keeleabi/artiklid2/kaubad.html

140 – 170 cm. • Pikkuseks on 3,3 kuni 3,6 meetrit.
140 - 160 bp 2-ahelaline DNA + histoonide oktameer.
140 - 141, 145, 153, 168 Winds code, 31-32, 34-35,

140 on tolle aja ooperimuusika stiilis.
140 - 37 Hasmoneide kuningriik.

1400 - 1461) Domenico Veneziano.
1400 - 1500. Inkade kultuur.



Tulemused kuvatakse siia. Otsimiseks kirjuta üles lahtrisse(vähemalt 3 tähte pikk).
Leksikon põhineb AnnaAbi õppematerjalidel(Beta).

Andmebaas (kokku 683 873 mõistet) põhineb annaabi õppematerjalidel, seetõttu võib esineda vigu!
Aita AnnaAbit ja teata vigastest terminitest - iga kord võid teenida kuni 10 punkti.

Suvaline mõiste



Kirjelduse muutmiseks pead sisse logima
või
Kasutajanimi / Email
Parool

Unustasid parooli?

UUTELE LIITUJATELE KONTO MOBIILIGA AKTIVEERIMISEL +50 PUNKTI !
Pole kasutajat?

Tee tasuta konto


Logi sisse ja saadame uutele kasutajatele
faili e-mailile TASUTA

Faili allalaadimiseks, pead sisse logima
või
Kasutajanimi / Email
Parool

Unustasid parooli?

UUTELE LIITUJATELE KONTO MOBIILIGA AKTIVEERIMISEL +50 PUNKTI !
Pole kasutajat?

Tee tasuta konto

Sellel veebilehel kasutatakse küpsiseid. Kasutamist jätkates nõustute küpsiste ja veebilehe üldtingimustega Nõustun