ttatcagttagctaactgctatatgggtcgggctgggttgataaactccggcggtgctgc gggcggtgaaactgacctcagcgatgcagtgcgtactgcggttatcaacaaacgcgcagg cggaatggggctgattcttggacgtaaagcgttcaagaaatcgatggctgacggcgtgaa actgattaacgccgtgcaggacgtttatctcgatagcaaaattactatcgcctga 2) CpG Islands CpG Islands results Results for 1053 residue sequence "eco:b2097 fbaB, dhnA; fructose-bisphosphate aldolase class I [EC:4.1.2.13]; K01623 fructose-bisphosphate aldolase, class I (N)" starting "atgacagata" CpG island detected in region 3 to 202 (Obs/Exp = 1.18 and %GC = 50.50) CpG island detected in region 18 to 217 (Obs/Exp = 1.19 and %GC = 50.50) CpG island detected in region 21 to 220 (Obs/Exp = 1.19 and %GC = 50.50) CpG island detected in region 24 to 223 (Obs/Exp = 1.19 and %GC = 50.50) CpG island detected in region 25 to 224 (Obs/Exp = 1.19 and %GC = 50.50) CpG island detected in region 26 to 225 (Obs/Exp = 1.19 and %GC = 50.50) CpG island detected in region 27 to 226 (Obs/Exp = 1.19 and %GC = 50.50)
4. Sisseimetava õhu temperatuur 5. Sisseimetava õhu rõhk Tagastussüsteem töötab keskmistel ja madalatel koormustel NOx vähenemine: kuni 50% Tahmasisalduse vähenemine: kuni 10% Süsivesinike (HC) vähenemine Müra vähenemine Vaakum elektriline Väljalaskegaaside jahutussüsteemi lülitamine http://www.youtube.com/watch?v=K0QAvF2PLsY&feature=endscreen EGR Trouble Codes: P0400....Exhaust Gas Recirculation Flow P0401....Exhaust Gas Recirculation Flow Insufficient Detected P0402....Exhaust Gas Recirculation Flow Excessive Detected P0403....Exhaust Gas Recirculation Control Circuit P0404....Exhaust Gas Recirculation Control Circuit Range/Performance P0405....Exhaust Gas Recirculation Sensor 'A' Circuit Low P0406....Exhaust Gas Recirculation Sensor 'A' Circuit High P0407....Exhaust Gas Recirculation Sensor 'B' Circuit Low P0408....Exhaust Gas Recirculation Sensor 'B' Circuit High P0409....Exhaust Gas Recirculation Sensor 'A' Circuit Kü sim us
Question 1 When converting an analogue value to a frequency, consider the following diagram describing the system. The frequency changes from 20 MHz to 18 MHz and the system samples at an interval of 2ms. How many counts does the microprocessor detect at, 2ms a) 20 MHz? =40000 counts 50 ns 2ms b) 18 MHz? =36 000 counts 55,55 ns What is the difference in terms of number of counts detected by the microprocessor? Between 20MHz and 18MHz are 4000 counts. Question 2 Consider the following diagram The frequency changes from 20 MHz to 18 MHz and the system samples at an interval of 100ns. a) What is the difference in terms of number of counts detected by the microprocessor? 10 MHz 10 MHz =5000 =5555,555 2000 Hz 1800 Hz Between 20MHz and 18MHz are 555,555 counts.
Homework-04 Solution (100 marks) Read Chapter_4_Time_Based_Measurements.pdf Question 1 (10 marks) When converting an analogue value to a frequency, consider the following diagram describing the system. The frequency changes from 20 MHz to 18 MHz and the system samples at an interval of 2ms. How many counts does the microprocessor detect at, a) 20 MHz? b) 18 MHz? What is the difference in terms of number of counts detected by the microprocessor? Solution: 1 1 a) Converse 20 MHz to time length: T 0.00005ms f 20,000,000 2ms Number of counts in 2ms: N 40,000 0.00005ms 1 1 b) Converse 18 MHz to time length: T 0.000055556ms
Tsunamis are caused by an underwater earthquake, a volcanic eruption, an sub-marine rockslide, or, more rarely, by an asteroid or meteoroid crashing into in the water from space. Most tsunamis are caused by underwater earthquakes, but not all underwater earthquakes cause tsunamis - an earthquake has to be over about magnitude 6.75 on the Richter scale for it to cause a tsunami. About 90 percent of all tsunamis occur in the Pacific Ocean. Many tsunamis could be detected before they hit land, and the loss of life could be minimized, with the use of modern technology, including seismographs (which detect earthquakes), computerized offshore buoys that can measure changes in wave height, and a system of sirens on the beach to alert people of potential tsunami danger.
by theory. The axis of this magnetic field is aligned parallel to the planet's rotation axis, contrary to thecircumstances in both Jupiter and Earth. The boundary of the magnetic field varies due to changes in the pressure of the solar wind on the sunward side,as was found in the case of Jupiter. The atmosphere of Saturn has weak bonds and there is a high haze, perhaps composed of crystals of ammonia ice, above the clouds. Apparent high-speed jet streams were also detected in the atmosphere. Confirming ground-based measurements, the cloud-top temperatures were measured at about -200 degrees Celsius (-330 degrees Fahrenheit), and only about 73 degrees Celsius (130 degrees Fahrenheit) above absolute zero. The Pioneer 11 voyage also discovered radiation belts that are weaker than those of Jupiter. The radiation is absorbed by the rings and moons of Saturn. Cutoffs in the radiation
1.The Authorized Version, commonly known as the King James Version, King James Bible or KJV. English translation of Christian Bible. Translation began by the church of england in 1604 and completed in 1611. It was the third official translation into english. The first was the great bible which was made during the reign of kind henry VIII and the second was bishops bible. They started making the new version in 1604 because the puritans(a factino within the church of england) perceived (detected)problems with earlier translations. 2.The translation was done by 47 scholars, all of who were members of the Church of England. The New Testament was translated from Greek, the Old Testament was translated from Hebrew text, while the Apocrypha were translated from the Greek and Latin. Over the course of the 18th century, the Authorized Version supplanted the Latin Vulgate as the standard version of scripture for English speaking scholars. Person on the picture is william tyndale
of a marvel, not only for their outlandish dress and beards and winged ships but even more for their wonderful technology - steel knives and swords, fire-belching arquebus and cannon, mirrors, hawkbells and earrings, copper and brass kettles, and so on. However, conflicts eventually arose. As a starter, the arriving Europeans seemed attuned to another world, they appeared to be oblivious to the rhythms and spirit of nature. Nature to the Europeans - and the Indians detected this - was something of an obstacle, even an enemy. It was also a commodity: A forest was so many board feet of timber, a beaver colony so many pelts, a herd of buffalo so many robes and tongues. Even the Indians themselves were a resource - souls ripe for the Jesuit, Dominican, or Puritan plucking. It was the Europeans' cultural arrogance, coupled with their materialistic view of the land and its animal and plant beings, that the Indians found repellent. Europeans, in sum, were
concentrations of greenhouse gases produced by human activities.In 2010 that finding was recognized by the national science academies of all major industrialized nations. Affirming these findings in 2013, the IPCC stated that the largest driver of global warming is carbon dioxide (CO2) emissions from fossil fuel combustion, cement production, and land use changes such as deforestation. Its 2013 report states:Human influence has been detected in warming of the atmosphere and the ocean, in changes in the global water cycle, in reductions in snow and ice, in global mean sea level rise, and in changes in some climate extremes. Initial causes of temperature changes Greenhouse gases The greenhouse effect is the process by which absorption and emission of infrared radiation by gases in a planet's atmosphere warm its lower atmosphere and surface. It was proposed
It is expected that wheat, havinglarge genome size (16.94 Gb), might contain many more SNARE genes. · We identified three SNARE homologue genes (SNARE3, SNARE5 and SNARE6) from the wheat cultivar HD2329 + Lr28 using homology searches. · The phylogenetic tree shows that SNARE3 and SNARE5 belong to Qc II group and SNARE6 belong to Qb II group. · With the help of Modeller software 3-D structures were predicted for all the three SNARE genes. The -helical coiled coil structures were detected in all three models. · The model of the polypeptide encoded by SNARE6 seems to have two stretches of - helical coils, separated by a small turn and the two coils fold onto each other as a hairpin. · This is analogous to SNAREs called SNAPs (SNAP-25, SNAP-29, SNAP-47) which are referred to as the Qbc SNAREs, as they contain two SNARE domains (both Qb & Qc) in a single polypeptide chain and they fold upon each other during SNARE complex formation.
The data obtained by sequencing individual clones suggested young sponges had been used. considerable repeatability of signal intensity values; the mean In the experiments where DNA was extracted from young standard deviation of the standardized signal intensities for each sponges grown from about a thousand gemmules, only the ITS1 position was around 5%. Every position in the sequence had a sequence variants of 253 nt and 254 nt were detected above the specific repeatable value for a particular nucleotide. It allowed us 5% threshold (established from acceptable noise level in sequenc- to compare the results of different sequencing experiments of ing electropherograms). Whereas amplifying the DNA extracted highly similar sequences numerically and to construct the either from 1 gemmule or 5 gemmules, sequence variants of
human errors are caused by inadequate design - a notion that serves as an active consolation thanks to which the reader is delivered from their feeling of incompetence. Although majority of readers do openly embrace this deliverance, to reinstate its validity I would refer to aviation industry, known for continuous reissue of regulations upon the standards to which cockpit and other human-operable equipment should conform after any major accident where "human error" has been detected. They do recognize that the actual fault is with the machinery and that it should have been "designed for error" in the first place. "To err is human" Norman states, and I wholeheartedly agree. Norman, quite interestingly, goes as far as to absolve some designers of their sins, at least partially, demonstrating a great deal of common sense in doing so. The fault is often with the industry, with the society and with the unbending bureaucracy and inertia of the whole civilized mechanism -
inspect each byte in the payload until EOF sequence. If byte(i) = DLE: if byte(i+1) = DLE -> indicates point links) flag = 01111110, unique byte pattern for SOF & EOF frame read on · Control field for unnumbered frames (lacking sequence This might happen because of: inadvertent DLE discard byte if byte(i+1) =ETX -> indicates end of frame 8 bit boundaries until EOF detected reception terminated. numbers) is shorter than for information/supervisory the loss of carrier, > Bit stuffing 1. scheme: flags (often used on point-point links) flag = 01111110, unique byte pattern 2. scheme: SOF delimiter & length indicator i) receiver searches for SOF delimiter frames authentication failure,
as yoga, pilates, dancing, tai chi and intensive stretching trainings. These kind of exercises strenghten the joint as well as relieve pain in case it becomes evident. Learning the normal range of motion of every joint is recommended in order to prevent hyperextension. One can protect the joints by using supportive bandages, paddings or braces during physial activities as well. Joint hypermobility needs a prompt reaction when discovered at an early age. If JMS is detected as a child, hyperextension may not form at all.4 Based on the information Mayo Clinic5 provides, a child who has a tendency for double-jointedness may eventually lose the ability to hyperextend oneself. As a matter of fact, it is not true6 because the people who are unusually flexible, have a condition of hyperlaxity or are able to bend over a normal person’s pliability have better chances to improve their flexibility. Although the more muscle mass one has, the less flexible one is
(>60) of animals representative of the patient being tested. Accuracy may differ according to age of patient, species, sex, diet, weight, time of day, and activity status. For example, reference ranges for hemoglobin concentration are age- and sex-dependent As another example, an antigen-based heartworm test is the gold standard, antemortem diagnostic test for dogs; however, cats often have low worm burden, unisex worm infestations, or immature worm infestations that are not readily detected by these tests Thus, sensitivity is much lower in cats, and this test would not be appropriate as a gold standard for testing cats. Established reference ranges and interpretation of results are only valid for the methods and the laboratory described. Reference ranges generally represent the range of test results from a subpopulation of healthy patients, and values that apply to 95% of the subjects evaluated are included within the range
1 System development • Modelling in early system development stage corrects design errors before construction. • Beneficial modelling reasons (– Insight: in the design and operation of a system – Completeness: detection of missing parts for simulation and a better understanding of the system requirements – Correctness: errors and flaws are usually detected, problematic scenarios can be reproduced, systematic error investigation) 2 Introduction CPN • CPN is a graphical language for concurrent system design and analysis and also general-purpose modelling environment and also applicable for industrial projects and high level programming. • Petri nets provide(– graphical notation– modelling concurrency, communication, synchronisation)
and CPM1A-40CDR-j(-V1)/40CDT-D(-V1)/40CDT1-D(-V1) PCs have 4 quick-response input terminals. (The same terminals are used for quick-re- sponse inputs and interrupt inputs.) Quick-response inputs have an internal buffer, so input signals shorter than one cycle can be detected. Overseeing Program I/O Overseeing Program I/O processes execution refreshing processes execution refreshing Input signal (00003) IR 00003 One cycle
as memory. SEROTONIN – A monoamine neurotransmitter which plays a role in temperature regulation, sensory perception or sleep. Probably implicated in depression. SODIUM-POTASSIUM PUMP – ATP*-linked enzyme* embedded in the neuronal membrane* which expels Na+ ions* from the inside and imports K+ ions from the outside to inside of the neurone*. This process is energy-dependent as it works against the gradient of ion concentration. STIMULUS – An environmental event which may be detected by sensory receptors. STROKE – An impeded blood supply to the brain, caused by a blood clot or a rupture of the blood vessel. Deprived of oxygen, which is carried by blood, neurones die in the affected brain area. SULCUS – The shallower grooves on the brain surface (deeper groves are called fissures). Plural = sulci. SYMPATHETIC NERVOUS SYSTEM – Part of the autonomic nervous system*, responsible for mobilizing the body’s resources during times of stress and arousal. It
Biochemical tests Biochemical tests used in the identification of infectious agents include the detection of metabolic or enzymatic products characteristic of a particular infectious agent. Since bacteria ferment carbohydrates in patterns characteristic of their genus and species, the 2 detection of fermentation products is commonly used in bacterial identification. Acids, alcohols and gases are usually detected in these tests when bacteria are grown in selective liquid or solid media. The isolation of enzymes from infected tissue can also provide the basis of a biochemical diagnosis of an infectious disease. Serological methods are highly sensitive, specific and often extremely rapid tests used to identify microorganisms. These tests are based upon the ability of an antibody to bind specifically to an antigen. The antigen, usually a protein
Peripheral venous blood (2 ml anticoagulant with heparin) was obtained by a trained phlebotomist 10 min before the TSST and again 50 min after the TSST. The whole blood was centrifuged (250g for 10 mins) and the resulting plasma layer was removed, aliquoted and stored at 70 oC for cytokine analysis. All samples were numerically coded (known to the principal investigator) and laboratory measurements (see below) undertaken blind. 2.3.1 Detection of Plasma IL-6 Plasma IL-6 was detected using commercially available paired antibodies enabling cytokine detection in an ELISA (Enzyme Linked ImmunoAssay) format (R & D systems Ltd, Abingdon, UK). The sensitivity for the IL-6 ELISA was 9 1000 pg/ml. There was no reported cross-reactivity with other cytokines (R & D systems Ltd, Abingdon, UK). Emotion regulation in relation.. 1 2.3.2. Detection of Salivary Cortisol
satisfactory. In 1999, Fazekas et al. [19] located pill regions on fabric samples by combining template matching techniques and image thresholding. Special illumination arrangements, i.e. a bi-directional illumination, were used to grasp the depth information from images, so that pills were properly segmented from the background (see Figure 8). FIGURE 8. Bi-directional illumination used for pill-detection by Fazekas et al [19] Finally, statistically comparing the number of pills detected over a given area with the assessment (quality classification) given by the textile experts, it is possible to empirically determine the optimal threshold values - measured in pills per area - between the quality classes defined by the standard. A remarkable approach to extract pill features from fabric images was proposed in [21 20]; using a two-dimensional Gaussian fit theory, authors train a “pill template'' using actual pill images and
saamiseks geeni konversiooni. Lahknesime 500 miljonit aastat tagasi. Potentsiaal 10 neljateistkümnendas astmes erinevat retseptorit. Imetajatel 10 kaheksandas astmes erinevat T raku tetseptorit. Silmud sekreteerivad antikehalaadseid struktuure, mis on stabiilsed pH 1,5-11.0 juures ja temperatuuril 56° umbes nädal. Need on nii sekreteerituna kui B-lümfotsüüdi pinnal. Kõrge aviidsus- Spore agglutination by VLR4 was detected at a concentration 1,000-fold more dilute (5 pg/ml) than the mouse monoclonal antibody (5 ng/ml). Antikehade korral peame rääkima aviidusest, mitte afiinsusest, sest tal on kaks äratundvat piirkonda. Alates luukaladest on antikehad. Silmudel pole, aga neil on midagi muud. Pole rekombinatsioonimehhanismi, retseptorid/antikehade laadsed molekulid mitmekesisuse saamiseks kasutavad geenikonverisooni. Afiinsus ja aviidsus. Afiinsus – korrektne olla siis ei saa me rääkida
The speed range is defined in relation to nominal speed. A Speed regulator is a controlled drive. It features a control system with power amplification and a feedback loop and is described as ,,closed loop". The speed of the motor is defined by a reference value. That value is continiously compared with a feedback signal, which is an image of the motor speed. This signal is supplied either by a tachogenerator or by a pulse generator connected ate the motor shaft end. If a deviation is detected following speed variation, the values applied to the motor (voltage, frequency or both) are automatically corrected in order to restore the speed to its initial value. 37 Kasutatud kirjandus L. kukk, kirjalike tööde koosstamise ja vormistamise juhend Automaatreguleerimise konspekt http://et.wikipedia.org/wiki/Automaatika V. Purro, Kursuseprojekti juhend Elektromootori kiiruse automaatreguleerimissüsteem
·The principal component that implements 2PL is a lock manager from which concurrent processes or threads acquire locks on every shared resource they access. ·Lock manager grants lock if request does not conflict with already granted locks. ·Two phase locking guarantees serialisability. Deadlock ·2PL may lead to processes waiting for each other to release locks. ·These situations are called deadlocks. ·Deadlocks have to be detected by the lock manager. ·Deadlock detection uses wait-for graph ·Deadlock wait-for graph contains cycle ·Complexity of Detection: O(N) with N number of concurrent transactions ·Deadlocks have to be resolved by aborting one or several of the processes involved. ·This requires to undo all the actions that these processes have done. ·Strategies: Abort Transactions that consumed least processor time Abort Transactions with most dependencies 22. The Two-Phase Commit Protocol
some of them are involved in project managing for some significant customers, although it is generally advisable to inform the prioritizing team about such incentives to keep the picture in accordance with the real state of things. Periodic reports on accomplishments are also customary. The control part of the conventional cycle is not, however, strictly enforced and happens haphazardly. Should unsatisfactory execution of a task be detected it is discussed by the head of IT department with the responsible employee and it is assured that the latter is made aware of advisable improvements to the execution. As has been mentioned before, a lot of stock is put into ability of employees to govern themselves and adhere to practice of care and devotion. 4. Development Program 4.1.Expenses Typical expenses of IT department can be divided into following categories: Employee's monthly salaries
environmental analysis. Inorganic ions and organic acids, which are traditionally determined by ion chromatography, may also be analyzed CZE. Since ions, in general, are not chromophores and even absorb ultraviolet light, it is necessary to operate with indirect UV detection. For this use as buffer solutions are used solutions of chromate or imidazole and detected at a buffer maximum absorption wavelength (e.g., 254 nm for chromate). 14 Ions of eluting sample displace chromate ions and thereby reduce the absorption, whereby "negative" peaks appear. Due to the high mobility of small ions EOF is not strong
Nearly one third of them are in an advanced stage of cancer. As in most countries, getting cancer is becoming more and more frequent. According to the Estonian Cancer Register, the frequency has increased about 30% during the last decades. The choice of my yearpaper subject was based on that information. It was shocking to learn that breast cancer is one of the biggest causes of death The main reason why cancer is detected too late, is because women are not aware of the risks of getting cancer. Thereforehe the purpose of my yearpaper is to give thorough information about preventing, detecting and treating breast cancer. In my yearpaper I am looking answers to three big questions: What is breast cancer? How to diagnose breast cancer? How to treat breast cancer? Putting together the paper I used mostly material from the Internet but also from a few books on that subject.
numerous and organized into more complex chains that individually drain proportionately smaller areas of tissue. Significant differences in NK cell biology between mice and man have been identified. Mouse NK cell activity in spleen and blood tends to peak early in life (4/10 weeks of age) while in man, NK cell activity is relatively stable throughout life. Mice have high, whereas man has low, NK cell activity in the lung. Fc receptors are easily detected on human, but markedly less so on mouse NK cells.
organize some kind of response. In considering two possible translation scenarios for Transylvania and Beyond and Exit into History, we have detected two particularly sensitive areas for further Perspectives: Studies in Translatology 323 foreignization: (1) the samples of Romanian language in the text; and (2) the conclusive cliche´ images of the Romanian culture.
Hopkins and Thompson 2002; Sentandreu et tified in mammals (Suzuki et al. 2004). Six al. 2002). different calpains are expressed as mRNA in Cathepsins often are not considered as the mammalian skeletal muscle, but only μ- important in meat tenderization because their and m-calpains and p94/calpain 3 isoforms membrane-bound location is thought to limit can be detected at the protein level (Sorimachi substrate accessibility. Lysosomes are inca- et al. 1990; Spencer et al. 1995; Sorimachi pable of engulfing the myofibril structure and and Suzuki 2001; Huang and Wang 2001). no myofibrillar fragments have been identi- The Ca2+ requirements, optimum pH and Aging/Tenderization Mechanisms 89 temperature of activity, autolysis, and inhibi- Geesink et al. 2005). Although the mRNA
· Scrub and garden habitats particularly important · Scrub is `natural' habitat that provides shelter and somewhere to locate sett.. but does not ecplain small ranges · Importance of garden habitat: o Abundant food available in gardens: 53% of households provided food, either deliberately or inadvertently o When they included a large proportion of garden habitat ranges tended to be small · Configuration of group ranges: o Latrines not detected at shared territory boundaries, not significalling between groups o Females exhibited no interaction between groups; male groups overlapped slightly (one male used two group ranges). Neither sex consistently defended shared territory boundaries using scent. Why obvious territory defence? · What are the results worth defending? o Foor resource? o Setts? o Intruder pressure too high or too low
1689. aastal esmakordselt ilmavalgust näinud teos koosnes kahest traktaadist ja tervikväljaande pealkirjaks oli Kaks traktaati valitsemisest: Esimeses esitatakse ja lükatakse ümber Sir Robert Filmeri ja tema järgijate valed põhimõtted ning lähtealused. Teine on essee tsiviilvalitsuse tegelikust algusest, ulatusest ja eesmärgist (Two Treatises of Government: In the Former, The False Principles and Foundation of Sir Robert Filmer, And His Followers, are Detected and Overthrown. The Latter is an Essay Concerning The True Original, Extent, and End of Civil Government). Siin ja edaspidi tõlkija märkused. 2 Siin ja edaspidi järgitakse kaldkirja puhul autori kasutust, v.a pärisnimedes, tsitaatides ja viidetes Piiblile. Viimasel juhul, nagu ka piiblisalmide tõlgetes, kasutatakse Eesti Piibliseltsi poolt 2000. aastal väljaantud Piiblit. 3 "Esimeses traktaadis" arvustas Locke Robert Filmeri (15881653) 1680. aastal ilmunud raamatu
There have been few books (e.g. Trubetsky) written about it and the comprehensiveness of the books is rather questionable. This is why the bachelor´s thesis set out to not only cover the existing sources but also, to further discuss some topics and questions, ten interviews were conducted with (former) punks involved in the punk movement in Soviet Estonia. The first manifestations of punk culture arriving to the Estonian SSR could be detected in the later years of the 1970s, largely due to the fact that Finnish TV channels could be watched in Northern Estonia and thus enabled the youth of Soviet Estonia to get a glimpse of bands like The Sex Pistols etc. The punk movement in Soviet Estonia started gathering momentum with the unarranged youth protest that took place in Tallinn in 1980 when the punk band Propeller was not allowed to perform by the authorities. The movement slowly began spreading all over
for all. He proves that he knows her well when he tells her she is suffering from the guilt of society and her family, and she can never really be a whole person again unless she detaches herself from those forces. "He vividly recalled all the constantly recurring instances of inevitable necessity for lying and deceit, which were so against his natural bent. He recalled particularly vividly the shame he had more than once detected in her at this necessity for lying and deceit. And he experiences the strange feeling that had sometimes come upon him since his secret love for Anna. This was a feeling of loathing for something-- whether for Aleksey Alexandrovich, or for himself, or for the whole world, he could not have said. But he always drove away this strange feeling. Now, too, he shook it off and continued the thread of his thoughts." It is a big moment for Vronsky, one unanticipated
the reflective strip. Both types of optical sensors have some common characteristics that must be taken into account when designing a system that uses them, as detailed in the following sections. Figure 3.7 Reflective optical sensor. 60 Analog Interfacing to Embedded Microprocessors Speed The phototransistor in any optical switch is fairly slow. This limits the maximum speed that can be detected. Typical numbers are 8 ms turn-on time and 50 ms turn-off time. This time is driven by the speed of the base-emitter junction. Gain The LED and phototransistor pair have a limited gain, usually less than one. The amount of current generated in the phototransistor collector for a given current through the LED is called the current transfer ratio (CTR). A typical CTR for a slotted switch is .1. This means that 10 ma of current in the LED will result in 1 ma of current in the collector
predict No one can anticipate the results of the games. They planned their vacation with anticipation. conform v. to follow established rules or patterns of n. conformity behavior n. conformist Syn. adapt Yon must conform to the rules or leave the club. She has always been a conformist. detect v. to find out, to observe something n. detection Syn. notice n. detective He detected a smile on his girlfriend's face. They are the best detectives on the police force. enrich v. to make rich, to make something of n. enrichment greater value adj. enriching Syn. enhance The fine arts enrich our lives. The discovery of oil was an enrichment for the country. intensify v. to make stronger in feeling or quality n. intensity Syn. heighten adj. intense adj. intensive adv
construction of complex steel structures. The research is based on qualitative case study methodology, focusing on the Seattle Central Library and the Denver Art Museum. In support of the main research question, the following sub questions were investigated: 5 • How are 3D and BIM affecting the structural design process? • How are clashes detected? • How is the steel fabrication and submittal process changing? • How is this technology affecting steel erection? • What tools are being used to collaborate between various project participants from different countries? Chapter 1 contains a review of the relevant literature that was found during the data collection process. Chapter 2 discusses research methodology and explains the sample selection and data analysis criteria
products'), are separated and cleaned at a gas processing plant. The by-products, once removed, are used in a number of ways. For example, propane can be used for cooking on gas grills. Because natural gas is colorless, odorless and tasteless, mercaptan (a chemical that has a sulfur like odor) is added before distribution, to give it a distinct unpleasant odor (smells like rotten eggs). This serves as a safety device by allowing it to be detected in the atmosphere, in cases where leaks occur. 56 Most of the natural gas consumed in the United States is produced in the United States. Some is imported from Canada and shipped to the United States in pipelines. Increasingly natural gas is also being shipped to the United States as liquefied natural gas(LNG). We can also use machines called "digesters" that turn today's organic material (plants, animal wastes, etc.) into natural gas
7 pass, allele / mutation, to offspring; R gene / resistance 8 allele frequency increases; 9 rapid because, multiplicative phase / short generation time / large 10 numbers offspring / many breeding sites; max 5 (ii) Plasmodium inside, liver cell / red blood cell; antibodies cannot reach target / cannot be detected by immune system; large genome; antigenic variation / AW; variation from meiosis; detail; e.g. independent assortment / crossing over parasite switches between different versions of proteins; ref var gene; max 3 (b) (i) marks in pairs - one pair only mutation; with lack of production;
this is a wide “vocalisation” (Flute, Clarinet and Violins): like the plaintive song of a lost soul: Example 10. In the slightly extended development section all the thematic material has been remarkably transformed. The music of Kapp, in accordance with his nature, is intrinsically dynamic. The introductory theme is remodelled at the end, in a powerful imperative movement. The influences of Beethoven and Tchaikovsky may be detected. The score is compact though not overloaded. Quick changes dart throughout the piece, the composer illustrates the inner contradictions, pain, hopes and poetry of the hero, 1 Inspired by Friedrich Schiller’s tragedy. 2 The city lies on the Volga River, near the Caspian Sea. 3 Pavlovsk is a town 30km outside St. Petersburg. The performance was in the summer of 1901, performed by the local orchestra under the baton of Kapp. 4 Tartu, Vanemuine Theatre, 17 Aug
RIME RelayNet International Message Exchange RIP Raster Image Processor + Remote Imaging Protocol + Routing Information Protocol [Novell] RIPEM Riordan's Internet Privacy Enhanced Mail RIPS Raster Image Processing System RISC Reduced Instruction Set Computing RIT Raw Input Thread [Microsoft] RJE Remote Job Entry RLD Received Line Detect RLE Run Length Encoded RLL Run Length Limited RLN Remote LAN Node [DCA] RLOGIN Remote Login RLSD Received Line Signal Detected RLSI * Ridiculously Large-Scale Integration RM Reset Mode RMA Return Material Authorization + Return to Manufacturer Authorization RMB Right Mouse Button RMC Raptor Management Console [Symantec] RMDIR Remove Directory RMI Remote Messaging Interface + Remote Method Invocation [Sun] RMON Remote Monitor/Monitoring RMP Remote Maintenance Processor [IBM] RMS Record Management Services + Root Mean Square RMW Read-Modify-Write RN Read News [Internet]
CAD from Tekla using IFC file exchange, the formwork and support towers were then designed, and finally the formwork models were returned to the construction model, again using IFCs. To the team's surprise, clashes were identified between the bridge cable anchors and the ties between formwork panels on opposite sides of the anchor. The formwork design was changed to resolve the issue (see figure 9.8.8 below). Fig. 9.8.8 Example of a clash detected between a cable anchor and formwork ties and its resolution. 9.8.4.3 Construction planning and 4D. The building model was first used during overall master planning meetings and then also in reverse phase scheduling meetings, which are a part of the Last Planner SystemTM. VICO ControlTM software was used for the master scheduling, with the model used only for visualization. The master schedule was then imported into the 'task manager' view of the construction model in Tekla Structures v
sortie next day. At 6 a.m. on November 26, the 32 ships of the force—six carriers, two battleships, and a flock of destroyers and support vessels— weighed anchor and sliced across the wrinkled surface of Tankan Bay. They steamed slightly south of east, heading into the "vacant sea"—the wintry North Pacific, whose wastes were undefiled by merchant tracks and whose empty vastness would swallow up the force. They had been ordered to return if detected before December 6 (Tokyo time); if discovered on December 7, Nagumo would decide whether or not to attack. Strict radio silence was enjoined. Aboard the battleship Hiei, Commander Kazuyoshi Kochi, a communications officer for the force, removed an essential part of his transmitter and put it in a wooden box, which he used as a pillow. The force drove eastward through fog, gale winds, and high seas. No one saw them. Meanwhile, Hull, after a frantic week of drafting, consultations, and
Mr. Darcy had at first scarcely allowed her to be pretty; he had looked at her without admiration at the ball; and when they next met, he looked at her only to criticise. But no sooner had he made it clear to himself and his friends that she hardly had a good feature in her face, than he began to find it was rendered uncommonly intelligent by the beautiful expression of her dark eyes. To this discovery succeeded some others equally mortifying. Though he had detected with a critical eye more than one failure of perfect symmetry in her form, he was forced to acknowledge her figure to be light and pleasing; and in spite of his asserting that her manners were not those of the fashionable world, he was caught by their easy playfulness. Of this she was perfectly unaware; to her he was only the man who made himself agreeable nowhere, and who had not thought her handsome enough to dance with.
dilution, three types of colour restriction, agouti ticking and silver/golden shading. There are genes which control how evenly the hair is coloured i.e. the bands of colour on each hair. In agouti cats, it is easy to see different bands of colour using a magnifying glass. In cats with apparently solid-coloured fur, you would need a microscope. Even though the effect on an individual hair can't be detected, the overall effect on an area of fur is make the colour more or less dense i.e. darker or lighter. In general the self colours (with plain English descriptions) are: Colour name Plain English Description Albino White Amber Born black, brightens to bright apricot to cinnamon with age. Apricot Pink-brown or hot cream, with a metallic sheen, Beige Abyssinian/Somali: Non sex-linked cream, Fawn
4 If the bearing shells are to be used again 14 Oil the crankpin and draw the connecting the body member or panel, also from the engine (Section 13), keep the shell taped to its cap. rod down to engage with the crankshaft. or transmission. With the mounting withdrawn, 5 Feel the top of the cylinder bore for a wear Check that the bearing shell is still in position the centre bolt can be unscrewed and the ridge. If one is detected, it should be scraped in the connecting rod. flexible component detached (see illustrations). 8.13a Relative positions of piston 8.12 Fitting a piston/connecting rod directional arrow and oil squirt hole in 8.13b Arrow on piston crown must face
people for egoic reflection or as as ego enhancers; trying to make an impression on others through possessions, knowledge, good looks, status, physical strength,and so on; bringing about temporary ego inflation through angry reaction against something to someone; taking things personally, feeling offended; making yourself right and others wrong through futile mental or verbal complaining; wanting to be seen, or to appear important. Once you have detected such a pattern within yourself, I suggest that you conduct an experiment. Find out what it feels like and what happens if you let go of that pattern. Just drop it and see what happens. De-emphasizing who you are on the level of form is another way of generating consciousness. Discover the enormous power hat flows through you into the world when you sot emphasizing your form-identity. STILLNESS It has been said:”Stillness is the language God speaks, and everything
could feel every ridge and thick vein. From the way his eyes darkened and his sculpted mouth parted on quickened breaths, I knew he could feel the outline and damp heat of me as well. "Is this so awful for you?" I asked, rocking my hips. "Are you lying there thinking you're not giving me what I want because I'm in charge?" Gideon set his hands on my thighs. Even that innocuous touch seemed dominating. The edginess and sharpened focus I'd detected not long ago abruptly made sense to me-he wasn't restraining his force of will anymore. The tremendous power coiled inside him was now directed at me like a blast of heat. "I've told you before," he said huskily. "I'll take you however I can get you." "Whatever. Don't think I don't know you're topping from the bottom." His mouth curved with unapologetic amusement. Sliding down, I teased the flat disk of his nipple with the tip of my tongue. I blanketed him as
I felt my chin drop, my mouth open in astonishment, and heard low chuckles behind me at my reaction. Edward looked at me casually, the music still surging around us without a break, and winked. "Do you like it?" "You wrote this?" I gasped, understanding. He nodded. "It's Esme's favorite." I closed my eyes, shaking my head. "What's wrong?" "I'm feeling extremely insignificant." The music slowed, transforming into something softer, and to my surprise I detected the melody of his lullaby weaving through the profusion of notes. "You inspired this one," he said softly. The music grew unbearably sweet. I couldn't speak. "They like you, you know," he said conversationally. "Esme especially." I glanced behind me, but the huge room was empty now. "Where did they go?" "Very subtly giving us some privacy, I suppose." I sighed. "They like me. But Rosalie and Emmett..." I trailed off, not sure how to express my doubts. He frowned
annaabi.ee 
