Vajad kellegagi rääkida?
Küsi julgelt abi LasteAbi
Logi sisse

Valgud (0)

1 Hindamata
Punktid

Lõik failist

Valgud
Valgud mõjutavad
toidu maitset .
On aroomiühendite ja värvuse prekursoriteks.
Valkude
koostises:
1) Süsinik – 48-55%
2) Hapnik – 20-34%
3)
Lämmastik – 15-19,5%
4) Vesinik – 5-7,5%
5) Väävel –
0,3-2,5%

Ülesanded inimorganismis


  • Ensümaatiline/biokatalüütiline funktsioon
  • Regulatoorne funktsioon
  • Retseptoorne funktsioon
  • Struktuurne funktsioon
  • Kontraktiilne ehk mehhanokeemiline funktsioon
  • Varuaineline ehk troofiline roll
  • Energeetiline funktsioon
  • Detoksikatsioon
  • Transpordifunktsioon
  • Kaitsefunktsioon
  • Geeniregulatoorsed ülesanded
    Valkude üldine ainevahetus ja metabolism on lahutamatuses seoses aminohapete omaga .
    Asendamatuid aminohappeid peab kindalt saama
    toiduga.
    Valgud uuenevad pidevalt
    Oma osa on valkudel ka
    üldises energeetilises metabolismis.

    Valgusüntees


    Seedeensüümid
    (eriülesandega valgud) lõhustavad toidust saadavad valgud nende
    koostisesse kuuluvateks aminohapeteks. Seejärel moodustavad teised keharakkude ensüümid uusi valke, ühendades aminohapped uuesti
    erilisteks ühenditeks, mida kehal on vaja
    talitlemiseks.
    Valgusünteesi ajal toimub järgnev:
  • Aminohapped liituvad rasvadega -> moodustuvad lipoproteiinid (toimetavad kolesterooli kehas ringi ja sellest välja)
    Aminohapped liituvad süsivesinikega -> moodustuvad glükoproteiinid
  • Proteiinid liituvad fosforhappega -> moodustuvad fosfoproteiinid (nt kaseiin , mis on piimavalk )
  • Nukleiinhapped ühinevad valkudega -> moodustuvad nukleoproteiinid (tsütoplasma ja rakutuuma komponendid)
    Süsinik, vesinik
    ja hapnik, mis jäävad järele pärast valgusünteesi lõppu,
    muudetakse glükoosiks ja kasutatakse energiana. Lämmastikujääki
    (ammoniaaki) töötleb maks (muudab kusiaineks).

    Aminohapped


    Valgu koostises
    on ca. 20 aminohapet.
    Aminohappe
  • Valgud #1 Valgud #2 Valgud #3 Valgud #4 Valgud #5 Valgud #6
    Punktid 10 punkti Autor soovib selle materjali allalaadimise eest saada 10 punkti.
    Leheküljed ~ 6 lehte Lehekülgede arv dokumendis
    Aeg2011-12-06 Kuupäev, millal dokument üles laeti
    Allalaadimisi 39 laadimist Kokku alla laetud
    Kommentaarid 0 arvamust Teiste kasutajate poolt lisatud kommentaarid
    Autor MPatsaan Õppematerjali autor
    Konspekt

    Sarnased õppematerjalid

    thumbnail
    10
    docx

    Biokeemia kordamisküsimuste vastused 2

    tulemuseks on kaks identset DNA ahelat. 20. Kas üheahelaline nukleiinhape võib omada primaarstruktuurist kõrgemat järku struktuuri? Üheahelalised polünukleotiidid võivad sõltuvalt nende primaarstruktuurist ja keskkonnatingimustest esineda rea erinevate kõrgemat järku struktuuridena. 21. Joonistage võimalik kõrgemat järku struktuur, mille antud oligonukleotiid võib moodustada. (erinevad järjestused) UCAGUUGGAGCUUCCAACAUU AGUCAACCUGAAGGUUGUAA 22. Mis on valgu monomeerideks? Kõik valgud on polümeerid, mille monomeerideks on a-aminohapped. 23. Millised aminohapped on toodud joonisel? (kolm aminohapet 20 hulgast) 1. Valniin 2. Türosiin 3. Glutamiinhape 24. Joonistage -aminohappe üldine struktuur. H2N-C(R,H)=O(-OH) 25. Milline on nimetatud aminohapete kõrvalahela laeng pH 7 juures? a) asparagiinhape b) alaniin c) arginiin Vaatan kõrvalahelat, kui on COOH, kaob ära H ning tekib negatiivne laeng. Kui on =NH3+, siis kaob üks H ära

    Analüütiline keemia
    thumbnail
    6
    doc

    Toidukeemia eksamiks kordamisküsimused-vastuse d

    1. Toiduainete keemiline koostis. Levinuimad funktsionaalsed rühmad biomolekulides, sidemete liigid. Toiduained koosnevad orgaanilistest ( nt valgud, süsivesikud, enamik toiduvärvaineid) ja anorgaanilistest ühenditest ( nt keedusool, kergitusained). Levinuimad funktsionaalsed rühmad: -OH ­ hüdroksüülrühm, aminorühm, okso- (keto), karboksüülrühm, tiool, fosforüülrühm. Funkt rühmad ei tule Elemendid on omavahel seotud sidemetega. Keemiline side on aatomite vastastikune mõju, mis tagab terviku püsimise. Side on erineva tugevusega. Kõige üldisem on kovalentne side (tekib elektronpaar kahe aatomi vahel)

    Toidukeemia
    thumbnail
    15
    docx

    Molekulaar - ja rakubioloogia I kontrolltöö kordamisküsimused

    1,45A tavaline). Peptiidside on jäik ja samatasapinnaline- trans peptiidside. Osaliselt laetud: amiidrühma N on osaliselt positiivne, karbonüülrühma O osaliselt negatiivne. Keemiliselt väheaktiivne – stabllisus suur. Pro- tsükliline kõrvalahel välistab pöörde-cis peptiidsidemed- b- pööre Valkude järjestuses eristatakse N- ja C- terminust (vaba aminorühm ja karboksüülrühm). Valk kasvab alati N-terminusest C-terminusse. 4. Kuidas on defineeritud peptiidid ja valgud? Peptiid – aminohappejärjestus, millel puudub selgelt defineeritud kolmemõõtmeline struktuur, enamasti lühikesed ahelad (<100 aminohappe) Valk – polüpeptiidahel, millel on kindel kõrgemat järku struktuur (ja bioloogiline funktsioon), sageli kvaternaarstruktuur 5 Valgu struktuuritasemed, interaktsioonid, mis stabiliseerivad struktuure Valkude funktsionaalsus on tagatud nende kolmemõõtmelise struktuuriga- konformatsiooniga-, mis omakorda tuleneb valkude aminohappelisest

    Molekulaar - ja rakubioloogia loengud
    thumbnail
    4
    doc

    Karboksüülhapped

    hüdroksühapped on puuviljades ja teistes looduslikes allikates esinevad orgaanilised karboksüülhapped. Aminohapped e. aminokarboksüülhapped on keemilised ühendid, mis sisaldavad funktsionaalsete rühmadena nii aminorühmi kui ka karboksüülrühmi. Aminohapped on karboksüülhapped, mille alküülradikaalis on üks või mitu vesiniku aatomit asendunud aminorühmaga. Kodeeritavad aminohapped on eluks vajalikud 20 aminohapet, millest loodus on ehitanud valgud. Asendamatud aminohapped on aminohapped, mida inimese organism ise kas üldse ei tooda või toodab vähesel määral, nii et nende omastamine toidust on möödapääsmatult vajalik. Peptiidid on molekulid, mis koosnevad ridamisi peptiidsidemetega üksteise külge aheldatud aminohapetest. Polüpeptiidid e. valguahelad on peptiidsidemetega seotud aminohappejääkide ahelad, millest koosnevad valgud. 2. Ühine ­ Sisaldavad karboksüülrühma (-COOH)

    Keemia
    thumbnail
    5
    doc

    sahhariidid, nukleotiidid, valgud

    Nende tekitatud kahjustus põhjustab väärarengu sealsamas ja kohe, kui rakk või organ ei tule toime vigade kõrvaldamisega. Kantserogeensed ained: - polütsüklilised aromaatsed süsivesikud (NT: bensobüreen) - aromaatsed amiinid - anorgaanilised ained ja materjalid (NT: nikkel, asbest) - looduslikud ühendid (NT: hallitusseente mürgid alfatoksiinid) - sünteetilised ühendid pestitsiidide, värvainete ja ravimite hulgast VALGUD Kodeeritavad aminohapped Valkude ehitamiseks on kakskümmend kodeeritavat aminohapet. Igaühele neist vastab geneetilises koodis teatav sümbol. Valgu omadused tulenevad aminohappelisest järjestusest. Kõik kodeeritavad aminohapped on -aminohapped. Kodeeritavad aminohapped jagunevad asendamatuteks ja asendatavateks aminohapeteks. Asendamatuid aminohappeid sünteesivad taimed ja bakterid. Peptiidid

    Keemia
    thumbnail
    12
    docx

    BIOKEEMIA Mõisted

     Kihilis - voldiline struktuur, mida tagavad:  Peamiselt H-sidemed – lühikestes polüpeptiidides ahelasiseselt, pikkades polüpeptiidides ka naaberahelate vahel  AH-jääkide R-rühmade vahelised hüdrofoobsed jõud  Elektrostaatilised jõud erinimelise languga R- rühmade vahel Tertsiaalstruktuur -aktiivne, funktsiooni täitev valk (3D) – polüpeptiidahela spetsiifiline ülitihe kokkupakkimine, tagab valgu biofunktsiooni  Kerajas-ellipsoidne (gloobul, globulaarsed valgud, enamus valke, kõik ensüümid)  Niitjas (fibrill, fibrillaarsed valgud – kolageen, lihasvalgud)  Baasinfo kokkupakkimiseks – primaarstruktuuris  Kokkupakkimise protsessi osalevad  Polüpeptiidahela seostusvalgud  AH-jääkide R- rühmade vastastikused omavahelised toimed ja veemolekulidega (AH hüdrofiilsed rühmad asetuvad molekuli pinnale ja hüdrofoobsed molekuli sisemusse)  Need sidemed võivad olla tugevamad, kui sekundaarstrutuuri tagavad H-sidemed

    Biokeemia
    thumbnail
    2
    docx

    Aminohapped

    III. AMINOHAPPED. PEPTIIDID. 1. Aminohapped: molekuli ehitus, proteogeensete (valkudes esinevate, harilike) aminohapete üldarv, grupid tulenevalt keemilisest ehitusest, struktuurid, nimetused ning ühe- ja kolmetähelised koodid. Milliseid ebaharilikke aminohappeid teate? Aminorühm mis on seotud valgus on tetraeedrilise kujuga. Proteogeenseid aminohappeid on 20, mida peame teadma. Grupeerumine: Apolaarsed ehk hüdrofoobsed: Leutsiin(Leu,L), Proliin(Pro,P), Alaniin(Ala,A), Valiin(Val,V), Polaarsed ehk neutraalsed: Glütsiin(Gly,G), Seriin(Ser,S), Aspargiin(Asn,N), Glutamiin(Gln,Q), alaliigitus: happelised ja H+ loovutajas on Aspartaat(Asp,D), Glutamaat(Glu,E), Jälle apolaarsed: Metioniin(Met,M), Trüptofaan(Trp,W), Fenüülalaniin(Phe,F), Isoleutsiin(Ile,I), jälle polaarsed ehk laenguta: Treoniin(Thr,T), Tsüsteiin(Cys,C), Türosiin(Tyr,Y), ja aluselised ja h sidujad: Histidiin(His,H), Lüsiin(Lys,K), Arginiin(Arg,R). Veel saab grupeerida, nagu biokeemia praktikumiraamatus oli: ali

    Üldbioloogia
    thumbnail
    48
    pdf

    Biokeemia I test

    I. BIOKEEMIA AINE. RAKU EHITUS 1. Bioelemendid. Bioloogilised makromolekulid. Molekulaarne hierarhia rakus ja struktuuriline hierarhia eluslooduses. Keemiliste reaktsioonide põhitüübid rakkudes. Bioelemendid: C, H, N, O, P, S ­ moodustavad 99% kõikidest aatomitest inimkehas. Moodustavad tugevaid kovalentseid sidemeid. Makromolekulid ­ valgud (30-70%), RNA (10-20%), DNA (2-5%), polüsahhariidid (1-20%), lipiidid (1-20%) Molekulaarne hierarhia rakus: I Anorgaanilised eellased - CO2, H20, NH3, N2, NO3 II Metaboliidid ­ püruvaat, tsitraat, suktsinaat III Monomeersed ehituskivid ­ aminohapped, nukleotiidid, monosahhariidid, rasvhapped IV Makromolekulid ­ valgud, nukleiinhapped, polüsahhariidid, lipiidid V Supramolekulaarsed kompleksid ­ ribosoomid, tsütoskelett jne

    Biokeemia




    Kommentaarid (0)

    Kommentaarid sellele materjalile puuduvad. Ole esimene ja kommenteeri



    Sellel veebilehel kasutatakse küpsiseid. Kasutamist jätkates nõustute küpsiste ja veebilehe üldtingimustega Nõustun