Awadalla, P., Eyre-Walker, A. & Smith, J. M. 1999. Linkage disequilibrium and recombination in hominid mitochondrial DNA. Science 286: 2524-2525. Brinkman, F. S., Macfarlane, E. L., Warrener, P. & Hancock, R. E. 2001. Evolutionary relationships among virulence-associated histidine kinases. Infection and Immunity 69: 5207-5211. Brown, J. R. & Doolittle, W. F. 1999. Gene descent, duplication, and horizontal transfer in the evolution of glutamyl- and glutaminyl-tRNA synthetases. Journal of Molecular Evolution 49: 485-495. Garcia-Vallve, S., Romeu, A. & Palau, J. 2000. Horizontal gene transfer of glycosyl hydrolases of the rumen fungi. Molecular Biology and Evolution 17: 352-361. Carbone, I., Anderson, J.B. & Kohn, L.M. 1995. A group I intron in the mitochondrial small subunit rRNA gene of Sclerotinia sclerotiorum. Current Genetics 27: 166-176. Carbone, I. & Kohn L.M. 2001. A microbial population-species interface: nested cladistic and coalescent inference with multilocus data.
Kristina Raud YAGB-41 060290 c. Konsensuspuu leidmisel kasutada programmi CONSENSE. Vastus: Nucleic acid sequence Maximum Likelihood method with molecular clock, version 3.66 Empirical Base Frequencies: A 0.24439 C 0.24556 G 0.30445 T(U) 0.20560 Transition/transversion ratio = 2.000000 +stm_STM024 +--4 ! +spt_SPA025 --3 ! +sfl_SF4435 +--2 ! +ece_Z0213 +--1 +eco_b0201 Ln Likelihood = -2440.90431 Ancestor Node Node Height Length -------- ---- ---- ------ ------ root 3 3 4 0
Katalaasitest + Süsivesikute metabolism - Leutsiini arülamidaas + Antibiootikumid Tundlik: Ampitsilliin Polümüksiin B Tetratsükliin Tundetu: Vankomütsiin Penitsilliin G Fülogeneesipuu 16sRNA põhjal Kasutatud allikad Haematospirillum jordaniae gen. nov., sp. nov., isolated from human blood samples Antonie van Leeuwenhoek International Journal General And Molecular Microbiology Volume 109, issue 4, pp.493-500 DOI:10.1007/s10482-016-0654-0 B. W. Humrighouse . B. D. Emery . A. J. Kelly . M. G. Metcalfe . J. Mbizo . J. R. McQuiston (internetis artikkel 8.veebruar 2016)
Immunoassays can use the basic antibody antigen binding as the basis to produce an electro - magnetic or particle radiation signal, which can be detected by some form of instrumentation. Signal of unknowns can be compared to that of standards allowing quantitation of the target antigen. To aid in the diagnosis of infectious diseases, immunoassays can detect or measure antigens from either infectious agents or proteins generated by an infected organism in response to a foreign agent. Molecular diagnostics Technologies based upon the polymerase chain reaction (PCR) method will become nearly ubiquitous gold standards of diagnostics of the near future, for several reasons. First, the catalog of infectious agents has grown to the point that virtually all of the significant infectious agents of the human population have been identified. Second, an infectious agent must grow within the human body to cause disease; essentially it must
a) research topic: preparation of glycolide from glycolic acid; document type: journal, report; language: english, german. b) 56 Ilona Juhanson, 123964YASB c) d) 1,4-Dioksaan-2,5-diooni CAS NR on 507-97-6 e) 259 reference via preparation f) 3.3 Clyclopropane a) b) 75-19-4 c) 0.790±0.06 g/cm3; d) get references -> properties -> 1749 references e) 3.4 Aine otsing molekulaarvalemi järgi: C8 H9 N2 O2 a) Explore substances –> molecular formula –> C8H9N2O2 b) – >40 tulemust c) –> reactant or regent –> 10 tulemust d) 3.5 Aine otsing SciFinderi joonistusprogrammi abil: a) 1042 ainet Ilona Juhanson, 123964YASB b) Neist on võimalik osta (commercially available) 69. c) d) 1042 substances -> all substances -> product -> 1408 reactions e) 1408 reactions-> refine -> product yield -> 60%-80% -> 78 reactions f) 3.6 Artiklite otsing oma teema jaoks a) b) 1
PREPARATION. 3.3 ,,Aine otsing" a) Võtsin EXPLORE SUBSTANCES, seejärel SUBSTANCE IDENTIFIER, sinna kirjutasin CYCLOPROPANE b) Aine cyclopropane CAS RN on 75-19-4 c) Aine arvestusil tihegus on 0.790±0.06 g/cm3 c) Leidsin 1693 referaati d) Cyclopropane juures vajutasin nuppu GET REFERENCES ja valisin loetelust PROPERTIES 3.4 ,,Aine otsing molekulaarvalemi järgi" a) Valisin EXPLORE SUBSTANCES, sealt valisin MOLECULAR FORMULA ning sisestasin valemi b) Sellise valemiga leidsin 40 ainet c) Reaktandina on 6 reaktsiooni, reagendina 0 reaktsiooni d) Vajutiasin nuppu GET REACTIONS ning sealt valisin REAGENT (0 tulemust) ja REAKTANT (6 tulemust) 3.5 ,,Aine otsing SciFinder joonistusprogrammi abil" a) Antud struktuuri sisaldab 1014 ainet b) Neist on võimalik osta 68 c) Joonistasin struktuuri, leidsin ained, mis sisaldavad seda struktuuri, vajutasin kõrval REFINE ja COMMERCIAL ABAILIBILITIES
Kasutatud materjal: · http://www.victoriacollege.edu/dept/bio/Hydrolysis/hydrolysis.html · http://www.bloodsaveslives.org/donor/youth.cfm · http://www.cardiologe.de/patient/info/kurz_fuendig/Frau/horm_riskma · http://smk.mef.hr/znanost.htm · http://www.phantatomix.com/stock_images_02.htm · http://runews.rockefeller.edu/index.php?date=2002 · http://www.mediaspin.com/fivesenses/images/touch_receptors.jpg · http://www.umich.edu/news/MT/04/Fall04/story.html?molecular · http://ipmc.epfl.ch/page8675-en.html · http://www.bio.indiana.edu/~demaslab/current.html
Apoptoos on kontrollitud raku surm, mida juhib geen p53. See on kõige äärmuslikum kaitsemehhanism, kus organism kõrvaldab vähipotentsiaaliga rakud. Apoptoos on vajalik: a) vanade rakkude kõrvaldamiseks b) loote arengu käigus sõrmede ja varvaste tekkimiseks c) mutatsioonidega rakkude hävitamiseks. Materjalid: http://et.wikipedia.org/wiki/V%C3%A4hi_geneetika http://biomedicum.ut.ee/~mesila/patoanatoomia/KKT/KASVAJAD.html http://www.ebc.ee/loengud/maia_gen/GEN_21_24.htm#q22 `'Molecular Biology of the Cell'' Fifth Edition Alberts, Johnson, Lewis, Raff, Roberts, Walter 2008
in a much broader sense to describe the whole range of methods, both ancient and modern, used to manipulate organic materials to reach the demands of food production. So the term could be defined as, "The application of indigenous and/or scientific knowledge to the management of (parts of) microorganisms, or of cells and tissues of higher organisms, so that these supply goods and services of use to the food industry and its consumers.[2] Biotechnology combines disciplines like genetics, molecular biology, biochemistry, embryology and cell biology, which are in turn linked to practical disciplines like chemical engineering, information technology, and biorobotics. Patho-biotechnology describes the exploitation of pathogens or pathogen derived compounds for beneficial effect. Information technology -Information technology (IT), as defined by the Information Technology Association of America (ITAA), is "the study, design, development, implementation,
c) aine cyclopropane arvestuslik tihedus (predicted density): 0.790±0.06 g/cm3 b) mitu referaati leidsid? 1693 c) kuidas need referaadid leidsid? Tsüklopropaani juurde hiirega minnes tekivad väiksed noolekesed, neile vajutades võtsin Get Refences ja panin linnukese Properties ette ja vajutasin Get. 3.4. (2 P) Harjutusülesanne "Aine otsing molekulaarvalemi järgi". Leia ained, mille molekulaarvalem on C8 H9 N2 O2 Esita: a) otsivõimalus: Explore substances, molecular formula b) mitu ainet leidsid? 40 ainet c) mitu ainet nendest on saamisel reaktandi või reagendi (reaktant or reagent) osas? Reaktandina on kuus, reagendina puudus. d) kuidas leidsid need ained? Kui ained olid leitud, vajutasin Get Reactions ja seejärel tegin linnukese ühte ja pärast teise, esimene andis kuus tulemust, teine ei andnud ühtegi. 3.5. Harjutusülesanne"Aine otsing SciFinderi joonistusprogrammi abil". a) mitu ainet sisaldavad seda struktuuri? 1014
Leia referaadid (Get references), mis on seotud aine cyclopropane omadustega (properties). b) mitu referaati leidsid? 1693 c) kuidas need referaadid leidsid? Tsüklopropaani juurde hiirega minnes tekivad väikesed noolekesed, neile vajutades valisin Get Refences ja panin linnukese Properties ette ja vajutasin Get 3.4. Harjutusülesanne "Aine otsing molekulaarvalemi järgi" Leia ained, mille molekulaarvalem on C8H9N2O2 Esita: a) otsivõimalus: Explore substaces, molecular formula b) mitu ainet leidsid? 40 ainet c) mitu ainet nendest on saamisel reaktandi või reagendi (reaktant or reagent) osas? Reaktandina on kuus, reagendina puudub d) kuidas leidsid need ained? Kui ained olid leitud, vajutasin Get Reactions ja siis tegin linnukese ühte ja pärast teise. Esimene andis kuus tulemust, teine ei andnud ühtegi 3.5. Harjutusülesanne"Aine otsing SciFinderi joonistusprogrammi abil"
c) kuidas need referaadid leidsid? Kuna tsüklopropaani juurde hiirega minnes tekivad nooled, siis klikkasin neile. Sealt omakorda klikkasin get references'i peale ning linnukese panin properties'e ette. Seejärel sain tulemuse. Juhised ülesande lahendamiseks leiad: Introduction to Substance Searching 3.4. Harjutusülesanne "Aine otsing molekulaarvalemi järgi". Leia ained, mille molekulaarvalem on C8 H9 N2 O2 Esita: a) otsivõimalus: Klikkasin explore substances'le ning sealt valisin juba molecular formula b) mitu ainet leidsid? 40 c) mitu ainet nendest on saamisel reaktandi või reagendi (reaktant or reagent) osas? 9 d) kuidas leidsid need ained? Valisin analysis'e kategooriast reactant or reagent 3.5. Harjutusülesanne"Aine otsing SciFinderi joonistusprogrammi abil". Juhised leiad: Introduction to the SciFinder Drawing Editor Search by Exact Structure Search by Substructure Kasutades SciFinderi joonistusprogrammi joonista allpool toodud molekulaarstruktuur. Soorita otsing
– E=MC2 The Photoelectric Effect • Einstein hypothesized that the number of electrons released would not depend on the number of quanta, but the light’s energy. (Galenet) • Confirming his hypothesis through several experiments, Einstein won the Nobel Prize of 1921 for his works in this field. (Galenet) The Brownian Motion • Explained the movements of very small objects. (Galenet) • Examined molecular action that supported the Atomic Theory. (Galenet) The Theory of Relativity • First assumption was that the law of physics are the same from any frame of reference. (Galenet) • Second assumption was that the velocity of light will always be the same no matter what condition measured. (Isaacson, Einstein) • From the two assumptions, Einstein derived a mathematical relationship between the velocity of an object and its length.
angustifolia L. (Boraginaceae). Plant Systematics and Evolution, 301(3), 893910. http://doi.org/10.1007/s00606-014-1123-8 Koszalka, J., & Strzelczyk, J. E. (2015). Archaeobotanical reconstructions of field habitats and crops: the grange in Pomorzany near Kutno, 18th/19th c. Biodiversity Research and Conservation, 37(1). http://doi.org/10.1515/biorc-2015-0006 Kostamo, K., Toljamo, A., Antonius, K., Kokko, H., & Kärenlampi, S. O. (2013). Morphological and molecular identification to secure cultivar maintenance and management of self-sterile Rubus arcticus. Annals of Botany, 111(4), 71321. http://doi.org/10.1093/aob/mct029 Kostamo, K., Toljamo, A., Palonen, P., Valkonen, J. P. T., Kärenlampi, S. O., & Kokko, H. (2015). Control of downy mildew (Peronospora sparsa) in arctic bramble (Rubus arcticus ssp. arcticus). Annals of Applied Biology, 167(1), 90101. http://doi.org/10.1111/aab.12211 Krawczyk, E
kasutamist inimeste huvides. Kasutatud kirjandus 1. Moat, A.G. , Foster, J.W. , Spector, M.P. 2002. Microbial physiology. 4., parandatud tr. New York: Wiley-Liss inc. , 715 lk. 2. Zuckerman, M., Roitt, I.M., Mims, C.A., Goering, R.,Dockrell, H., Wakelin, D. 2004. Medical Microbiology. 3., parandatud tr.London: Mosby, 648 lk. 3. Wong, S.M., Alugupalli, K.R., Ram, S., Akerley, B.J. The ArcA regulon and oxidative stress resistance in Haemophilus influenzae. Molecular microbiology 2007 June; 64(5): 13751390. 4.Lee, J.W., Helmann, J.D. The PerR transcription factor senses H2O2 by metal-catalysed histidine oxidation. Nature 2006 March; 440: 363-367. 5.Imlay,J.A. How obligatory is anaerobiosis? Molecular microbiology 2008 May;68(4):801-804. 6. Paustian, T. Summary of Catabolism. ( http://dwb.unl.edu/Teacher/NSF/C11/C11Links/ www.bact.wisc.edu /microtextbook/metabolism/SummaryCatab.html) 7. Todar, K. Todar's Online Textbook of Bacteriology. (http://www
Statistiliselt on ML kõige võimsam meetod, kuna genereerib tõenäosushinnangud igale harule. Kuid tänu sellele on ML ka ülimalt aeglane, mis on antud meetodi suurimaks miinuseks. Lisaks ei pruugi alati õiged olla aluspaaride sageduste muutustesse puutuvad eeldused. Kolmandaks ei saa selle meetodiga arvesse võtta morfoloogilisi tunnuseid, kuna nende muutumiste tõenäosusi ei saa me kuidagi leida. Kasutatud materjalid: Bioinformatics and molecular evolution. By Paul G. Higgs and Teresa K. Attwood. Blackwell: Oxford, UK. ISBN: 1405106832 http://www.life.umd.edu/labs/delwiche/MSyst/lec/Likelihood-1.html (25.03.07) http://www.icp.ucl.ac.be/~opperd/private/phenetics.html (25.03.07)
kasutatakse peamiselt pakendites (kilekotid, kilekiled, geomembraanid, konteinerid koos pudelitega jne) (Wikipedia, Polyethylene, n.d.). Polüeteen on klassifitseeritud mitmesugustesse kategooriatesse, peamiselt tiheduse ja hargnemise järgi (Vikipeedia, Polüeteen, n.d.). Eristatakse: HDPE (high density polyethylene)-kõrgtihe polüetüleen LDPE (low density polyethylene)-madaltihe polüetüleen LLDPE (linear low density polyethylene)-lineaarne madaltihe polüetüleen UHMWPE (ultra high molecular weight polyethylene)-ülikõrge molekulmassiga polüetüleen. 3 POLÜVINÜÜLKLORIID (PVC) Polüvinüülkloriid ehk PVC on kõige enim kasutatav plastmass maailmas. PVC kasutatakse väga laialdaselt ning tänu oma mitmekülgsetele omadustele aitab ta kaasa suurele osale meie tänapäeva modernsest elustiilist, millega igaüks on harjunud. PVC-d ümbritsevad probleemid võib jagada kaheks
Different types of bonds absorb infrared radiation at different characteristics frequencies, IR spectrum 2941 O-H ( and C-H strech) ; 1721 C=O ; 1421 O-H bend ; 1269 C-O strech ; 945 O-H bend Quantitative determination UV-VIS 220 nm (ultraviolet light) Molecules containing pi-electrons or non-bonding electrons can absorb the energy in the form of ultraviolet or visible light to excite these electrons to higher anti-bonding molecular orbitals. The more easily excited the electrons the longer the wavelength of light it can absorb. Ultraviolet (10-380 nm) or visible (380-780 nm). HPLC HPLC non - polar stationary phase and polar mobile phase are used for reveres phase for ibuprofen Quick Efficient High resolution Accurate Analyse a blood sample containing Ibuprofen GC-MS can be used for the analysis the sample Meclofenamic acid can be used as internal standard
Pandas are not a species at an `evolutionary dead end' as is sometimes claimed, according to new research that has been carried out by scientists at Cardiff University and in Sichuan in China. Previous findings have suggested that the serious decline in giant panda numbers in modern times is related to its unusual dietary requirements the species exists almost entirely on bamboo habitat isolation and relatively slow reproductive rate. But this new study, published in Molecular Biology and Evolution, has uncovered an important relationship between the species' decline and human activities. "It is clear that the species has suffered at the hands of human activities such as deforestation and poaching," said Professor Michael Bruford. The research also shows that where habit conservation projects have been properly implemented, the giant panda is flourishing and its numbers are increasing. "Our research suggests we have to revise our thinking about the evolutionary
(LIMIT-TO(SUBJAREA, "ENVI") OR LIMIT-TO(SUBJAREA, "AGRI") OR LIMIT-TO(SUBJAREA,"PHAR") OR LIMIT- TO(SUBJAREA, "ENVI") OR LIMIT-TO(SUBJAREA, "AGRI") OR LIMIT-TO(SUBJAREA, "PHAR")) AND (LIMIT- TO(LANGUAGE, "English")) AND (LIMIT-TO(SRCTYPE, "j") OR LIMIT-TO(SRCTYPE, "k") OR LIMIT-TO(SRCTYPE, "b")) 1) Year: valisin aastad 2010-2013 2) Subject area: valisin teemavaldkondade seast Environmental Science; Chemistry; Biochemistry, Genetics and Molecular Biology; Medicine; Agricultural and Biological Sciences; Energy; Pharmacology, Toxicology and Pharmaceutics. 3) Document type: valisin article 4) Source type: valisin journals 5) Language: valisin English Relevantsed artiklid: 1) Preliminary risk assessment of radon in groundwater: a case study from Eskisehir, Turkey 2) Prevention measures against radiation exposure to radon in well waters: Analysis of the present situation in Finland
• Poistel enne 9. eluaastat • Poistel pärast 14. eluaastat Esinemissagedus • Esinemissagedus • Tüdrukutel 0,2% • Tüdrukutel 0,4% • Poistel <0,05% • Poistel 2% Teilmann et al., 2005, Encyclopedia of Molecular Pediatrics. Mechanisms of Disease, 2009 Enneagne puberteet - jaotus Enneaegne puberteet (precocious puberty) Gonadotropiinsõltuv Gonadotropiinsõltumatu • Hüpotaalamust haaravad kasvajad (hamartoom, glioom, • Autonoomne gonaadide aktivatsioon (MAS) astrotsütoom)
Eteen kõrgtihe polüeteen (HDPE): on venimisel tugevam kui LDPE, kuid rebeneb kergemini. See materjal sobib suurepäraselt särksangaga ja auksangaga kottide jaoks. Loomulikul kujul on HDPE ilma läiketa ja matt, krabisev. Kasutusvaldkond: kile, kilekotid, palstpudelid/kanistrid. LDPE hakkab madalamal temperatuuril sulama, sest sellel on kergem molekule lõhkuda. HDPE'l on suurem tihedus, sest tema molekulid on lineaarse struktuuriga aga LDPE struktuur on hargnemisi. UHMWPE- Ultra-high Molecular Weight Polyethylene (Ülikõrge molekulmassiga polüetüleen) - seda kasutatakse põhiliselt konveieritel liugpindadeks ja muudel kulumiskindlust nõudvates kohtades. 6. Homopolümeer Kopolümeer Kasutatakse näiteks (plast)kile Kasutatakse kummiliimide ja ja anumate valmistamisel; vahtplastide valmistamisel; koosneb ühesugustest elem- koosneb erisugustest elem- entaarlülidest
korrosioonile). Kõrgtihe polüetüleen (HDPE) omab kõige lihtsama ehituse, sest koosneb korduvatest etüleeni ühikutest -(CH2CH2)n-. Madaltihe polüetüleen omab sama keemilist valemit, aga erineb sellega, et omab hargnenud struktuuri -(CH2CHR)n-, kus R on -H, -(CH2)nCH3 või keerulisema ehitusega (joonis 1). Lineaarse HDPE molekulkaal on 200 000 ... 500 000, saadakse ka ülikõrge molekulkaaluga (3 000 000 ... 6 000 000) polüetüleeni (UHMWPE, ultra high molecular weight polyethylene). LDPE madaltihe polüetüleen LLDPE lineaarne madaltihe polüetüleen HDPE kõrgtihe polüetüleen Joonis 1. PE struktuurid PE on poolkristalliline (kristalliinne) termoplast, mis tähendab, et:
Being the newest and the best equipped fish cultivation unit in Estonia Põlula Center serves also as a base for education and research. Research and education in fish farming is carried out in Department of Fish Farming of Estonian Agricultural University, Tartu. The staff consists of four scientists and four assistants. Until 1990s the main task of it has been to develop suitable for Estonia technology of carp farming. Nowadays the fields of studies are molecular genetics of salmonid fish, quality of farmed fish, improvement of techology of new for Estonia objects of cultivation (sturgeon, crayfish, salmon), fish parasitology. A large carp farm (125 ha of ponds) near Tartu in Ilmatsalu has been the experimental base for the department. Today the selected broodstock of several strains of common carp is kept there and it acts as reproduction center producing carp fry for the whole Estonia. Estonian Fish Farmers Association was established in 1989
University of Washington, Seattle Kättesaadav: http://www.ncbi.nlm.nih.gov/books/NBK1161 2. Kantor D,Zieve D. 2010. Alzheimer's disease. Kättesaadav: http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001767 3. F00-F09 Orgaanilised-k.a. sümptomaatilised- psüühikahäired Kättesaadav: http://www.kliinikum.ee/psyhhiaatriakliinik/lisad/ravi/RHK/F0.htm 4. Lahiri DK, Farlow MR, Sambamurti K, Greig NH, Giacobini E, Schneider LS. 2003. A critical analysis of new molecular targets and strategies for drug developments in Alzheimer's disease. Current Drug Targets 4, 97-112. 5. Terry AV, Buccafusco JJ. 2003. The cholinergic hypothesis of age and Alzheimer's disease- related cognitive deficits: recent challenges and their implications for novel drug development.The journal of pharmacology and experimental therapeutics 306 (3), 821-827. 6. Ainetvahetushäired Patoloogilise anatoomia ja kohtuarstiteaduse instituudi loengumaterjal.
Tallinn 2013 Ott Speek Subject: English Geodesy Study group: GI-21b PETROLEUM PRESENTATION Petroleum (L. petroleum, from Greek: Πέτρα (rock) + Latin: oleum (oil) is a naturally occurring flammable liquid consisting of a complex mixture of hydrocarbons of various molecular weights and other liquid organic compounds, that are found in geologic formations beneath the Earth's surface. The name Petroleum covers both naturally occurring unprocessed crude oils and petroleum products that are made up of refined crude oil. A fossil fuel, it is formed when large quantities of dead organisms, usually zooplankton and algae, are buried underneath sedimentary rock and undergo intense heat and pressure. Petroleum is recovered mostly through oil drilling
The majority of aniline serves this market. Other uses include rubber processing chemicals (9%), herbicides (2%), and dyes and pigments (2%). Illustrative of the drugs prepared from aniline is paracetamol. The principal use of aniline in the dye industry is as a precursor to indigo, the blue of blue jeans. Like most volatile amines, it possesses the unpleasant smell of rotten fish. 2. Physico-chemical properties Name: Alinine CAS number: 62-53-3 IUPAC name: Phenylamine Molecular formula: C6H5NH2 Physical properties: Molar mass: 93.13 g/mol Appearance: colorless liquid Density: 1.0217 g/mL, Melting point: -6.3 °C Boiling point: 184.13 °C, 457 K, 363 °F Solubility in water: 3.6 g/100 mL at 20°C Solubility in ethanol: perfectly Viscosity: 3.71 cP (3.71 mPa·s at 25 °C) pH: >7 log Pow: 0.90/0.98 Koc: 25,5 3. Kinetics and metabolism
VEZT – arvatav tuumor-supressorgeen 3. Millised tegurid võivad olla põhjuseks, et assotsiatsiooniuuringud ei ole andnud endometrioosi geneetiliste põhjuste väljaselgitamisel häid tulemusi? Haiguse tekkepõhjus on heterogeenne Haigus ise heterogeenne Uuritud grupid liiga väikesed Kontrollide küsimus Valed eeldused geenide ja polümorfismide valikul Nathalie Brison 1. Indicate the wrong statement: molecular karyotyping (array CGH) can detect: a) balanced translocations b) cytogenetically visible deletions and duplications c) submicroscopic deletions and duplications d) both microscopic and submicroscopic deletions and duplications e) aneuploidy 2. Define Confined Placental Mosaicism. During which prenatal screening or diagnostic procedures can it occur and what are the clinical consequences? CMP tähendab kromosomaalse ülesehituse erinevust platsentarakkude ja looterakkude vahel
de- · fense layers (Zhang et 5. Kokkuvõte · Me oleme klooninud kolme täielikku open reading frame containing cDNA sequences of SNARE genes and analyzed their predicted proteins. · Taken together, this study represents the first systematic analysis of SNARE genes in wheat that provides early evidence of three wheat SNARE homologues to have a vital role in vesicle- mediated plant immunity. · For an understanding of the detailed molecular mechanisms and their exact role in wheat defense to leaf rust more detailed studies are needed.
Tallinn University Natural and exact sciences Molecular Biochemistry and Ecology Maria Gnidenko Capillary electrophoresis Essay Supervisor: Kert Martma
05. 2018) 8. Review of boceprevir and telaprevir for the treatment of chronic hepatitis C Kyle J Wilby, BSP ACPR, Nilufar Partovi, PharmD, Jo-Ann E Ford et.al https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3354889/ (07.05.2018) 9. Strategies to reduce hepatitis C virus recurrence after liver transplantation Ruben Ciria, María Pleguezuelo, Shirin Elizabeth Khorsandi et.al https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3664282/ (07.05.2018) 10. Joonis 1: The molecular and structural basis of advanced antiviral therapy for hepatitis C virus infection Ralf Bartenschlage, Volker Lohmann and Francois Penin http://www.nature.com.ezproxy.utlib.ut.ee/articles/nrmicro3046.pdf (07.05.2018) 11. Oligonucleotide-Lipid Conjugates Forming G-Quadruplex Structures Are Potent and Pangenotypic Hepatitis C Virus Entry Inhibitors In Vitro and Ex Vivo, George Koutsoudakis, Alexia Paris de León, Carolina Herrera et.al https://www.ncbi.nlm.nih
Ramirez Carillo, R. & Leal Lara, H. Breeding of Pleurotus and Lentinula hybrids by pairing of neohaplonts for commercial cultivation. In: IMC7 Book of Abstracts. Oslo. 264. Saville, B.J., Kohli, Y. & Anderson, J.B. 1998. mtDNA recombination in a natural population. Proceedings of the National Academy of Sciences, USA 95: 1331-1335. Schardl, C.L. & Craven, K.D. 2003. Interspecific hybridization in plant-associated fungi and oomycetes: a review. Molecular Ecology 12: 2861–2873.lishing Zolan, M.E. 1995. Chromosome-length polymorphism in fungi. Microbiological Reviews, 49: 686–698. Tamm, H. 2004. Seeneperekonna Peziza (Pezizales, Ascomycota) gruppide P. varia ja P. violacea ning lähedaste liikide fülogeneetiline analüüs rDNA ITS regiooni alusel. Bakalaureusetöö. Tartu Ülikool. Käsikiri. Tamm, H., Kullman, B. & Kullman, K. 2005. Fungal Genome Size Database. In:
Samuti tuleb hoolikalt jälgida ja vajadusel rakendada ettevaatusabinõusid nii võimaliku kartulilehemädaniku (Phytophthora infestans) nakkuse tekkeks kui selle leviku tõkestamiseks 15 4.Kasutatud kirjandus 1. Compendium of Transgenic Crop Plants, J.M. Bradeen, D.Carputo, D.S.Douches, USA, 2009 2. The top 10 fungal pathogens in molecular plant pathology, R.Dean, J.A.Van Kan, Z.A.Pretorius etc, USA, 2012 3. Powdery Scab of Potatoes, S.B.Johnson, UK, 2002 4. Plant Pathology,Academic Press, Agrios, G. N. New York, 1997 5. Nõuded seemnekartuli sordiomadustele ja külviväärtusele,Tallinn,1986 6. Kartulikasvatus, J. Jõudu, Tartu 2002 7. Kartuli kvaliteet ja seda mõjutavad tegurid, L. Tartlan, Tallinn 2005 8. Kartul, ilus hea ja kasulik, Jõgeva sordiaretuse instituut 9
utl.pt Mustafa M. Farouk AgResearch MIRINZ, Ruakura Research Daniel Y. C. Fung Centre, East Street, Private Bag 3123, Department of Animal Sciences and Hamilton 3240, New Zealand. Industry, 207 Call Hall, Kansas State E-mail: [email protected] University, Manhattan, Kansas 66506, USA. E-mail: [email protected] Alejandro Ferrando Departamento de Bioquímica y Biología Molecular, Facultad de Biología, Isabel Guerrero Legarreta Universidad de Valencia, Dr Moliner, 50, Departamento de Biotecnología, Burjassot, 46100 Valencia, Spain. Universidad Autónoma, Metropolitana, Unidad Iztapalapa, San Rafael Atlixco 186, Del. Iztapalapa, Apartado Postal 55-535, Pedro Fito C.P. 092340, Mexico City.
samamoodi kui loomarakke. Milliste tehnoloogiate abil sellest üle saadakse? Erinevalt loomarakust ümbritseb taimerakku paks tsellulooskest, mis on märksa tõsisemaks takistuseks kui lihtsalt membraan. Perhaps the most successful method involves the pathogenic bacterium Agrobacterium tumefaciens, which has the innate ability to transfer DNA to plant cells. In nature, this transfer results in formation of plant tumors (crown galls) at the infection site. Molecular biologists, however, have disarmed this bacterium and constructed domesticated strains that no longer cause tumors but transfer any DNA of interest to plant cells. The major disadvantage of the highly efficient Agrobacterium system is that it does not work with all plant species, most notably the cereals. Other techniques use physical or chemical agents to transfer DNA into plant cells. Protoplasts, plant cells that have been stripped of their protective cell walls, will take
Seega häired südamerütmis võivad kahjustada kogu organismi. Arütmiad ehk häired südame rütmis tekivad, kui esineb probleem südame erutusjuhtesüsteemis. Selleks võib olla häire impulsi tekkes, impulsi juhtivuses või mõlemas. Rütmihäirete põhjuste välja selgitamine omab kliinilist tähtsust, sest sellest sõltub patsiendi ravistrateegia ja ka edasine prognoos. Kasutatud kirjandus 1. Tristani-Firouzi M, Chen J, Mitcheson JS, Sanguinetti MC. 2001. Molecular biology of K + channels and their role in cardiac arrhythmias. The American journal of medicine 110:50-59. 2. Schmidt RF, Thews G. 1990. Inimese füsioloogia. lk.461-504 3. Lilly LS. 2003 . Pathophysiology of Heart disease. Lippincott Williams & Wilkins, lk 269- 286 4. Klabunde RE. 2005 . Cardiovascular Physiology Concepts. Lippincott Williams & Wilkins.
“Avatud” värava korral toimub GTP hüdrolüüs . EF-Ts. Ts: T – “temperature”, s- “stable”. Monomeerne valk. G-nukleotiidi vahetusfaktor (GEF) EF-Tu jaoks: EF-Tu•GDP + GTP EF-Tu•GTP + GDP EF-G. Monomeerne valk. 5 domeeni. GTPaasne aktiivsus (ribosoom-stimuleeritud). Katalüüsib mRNA-tRNA kompleksi translokatsiooni. Sarnaneb struktuurilt aa-tRNA-EF-Tu kolmikkompleksiga - molecular mimicry. Domeen IV liigub A-saiti sarnaselt tRNA antikoodon õlale. mRNA-tRNA kompleksi liikumine ühe koodoni võrra mRNA 3’ suunas . PRE-olek : deatsüleeritud tRNA P-saidis, peptidüül-tRNA A-saidis ↓ POST-olek : deatsüleeritud tRNA E-saidis, peptidüül-tRNA P-saidis Translokatsioon mRNA-tRNA kompleksi liikumine ühe koodoni võrra mRNA 3’ suunas, EF- G katalüüsib seda.
Omandatud immuunsusel on kahte tüüpi vastust: Ühe reaktsioonina (humoraalne vastus) sekreteerivad B-lümfotsüüdid antikehasid ja teise reaktsioonina (rakuline vastus) tapavad tsütotoksilised T-lümfotsüüdid viirusinfekteeritud rakke. Kuidas kaasasündinud immuunsus nakkuse ära tunneb? Nii selgrootutel kui ka selgroogsetel on Pattern Recognition Receptors (PRR), mis tunnevad ära patogeenidele omaseid molekulaarseid struktuure (Pathogen Associated Molecular Patterns - PAMP). PAMP need on kindlad molekulid ja struktuurid, mida leidub vaid prokarüootidel. PAMP-e toodavad vaid mikroobid ja seega kaasasündinud immuunsüsteem on võimeline tegema vahet oma ja võõra vahel. 3. Joonista adaptiivses immunsuses osalevad tähtsaimad molekulid: Ig, TCR, MHCI ja MHCII, millistel rakkudel need ekspresseeruvad, millistele struktuuridele seonduvad/milliseid peptiide seovad ja mis neid iseloomustab? alfa beeta
LISAD Joonis 1 15 Joonis 2 16 KASUTATUD ALLIKAD WHO Põhikiri. http://ee.euro.who.int/WHO_Pohikiri_mitteametlik_tolge.pdf (18.10.09) EUROOPA PARLAMENDI JA NÕUKOGU MÄÄRUS (EÜ) nr 178/2002. http://eur- lex.europa.eu/LexUriServ/LexUriServ.do?uri=CELEX:32002R0178:ET:HTML (18.10.09) Britannica. http://www.britannica.com/EBchecked/topic/9171/aging/63918/Aging-at-the- molecular-and-cellular-levels (18.10.09) Toitumissoovitused. http://www.eestitoit.ee/wp-content/uploads/2008/02/toitumissoovituste- s.pdf (18.10.09) Toitlustuse alused. http://koolielu.edu.ee/ehte/toitlustus/?5._Energiavajadus %2C_allergiad_ja_toitumine:Toitained%26nbsp%3B_ja_toidu_energeetiline_v%E4%E4rtus (18.10.09) Harvard. http://www.hsph.harvard.edu/nutritionsource/what-should-you-eat/pyramid/ (18.10.09) Amygdalin. http://en.wikipedia.org/wiki/Amygdalin (18.10.09) Fiile. http://www.fiile.ee/index
ribosomal DNA repeats: total rDNA repeat variation revealed by whole-genome 10. Van de Vyver G (1970) La non confluence intraspecifique chez les spongiaires et shotgun sequence data. Genome Res 17: 184191. la notion d9individu. Ann Embryol Morph 3: 251262. 3. Alvarez I, Wendel JF (2003) Ribosomal ITS sequences and plant phylogenetic 11. Murray MG, Thompson WF (1980) Rapid isolation of high molecular weight inference. Mol Phylogenet Evol 29: 417434. plant DNA. Nucleic Acids Res 8: 43214325. 4. Queiroz C de S, Batista FR, de Oliveira LO (2011) Evolution of the 5.8S 12. Higuchi M, Maas S, Single FN, Hartner J, Rozov A, et al. (2000) Point mutation
Heritability Shared Environment Unique Environment Posthuma, de Geus, Deary (2009) in The Genetics of Cognitive Neuroscience (MIT Press). Bouchard et al. (1990). Science, 250, 223-228. Page Davies et al. (2011) Molecular Psychiatry, 16, 996-1005. Deary et al. (2010) Nature Reviews Neuroscience, 11, 201-211. Intelligence, information processing and neuroscience · Intelligence correlates with... · Working memory and reaction time (Schacter pp. 362-364) · Speed of visual processing · Brain size (measured using structural magnetic resonance imaging) · Brain cortical thickness · Brain white matter integrity
Seega takistab interferoon viiruse levikut veel nakatamata rakkudesse ja seetõttu ka viiruse reproduktsiooni., komplement- Tunneb ära bakterite pinna komponente, mitmesugune toime (tekitab bakterite lüüsumist, fagotsütoosi jne) kollektiinid, PRP- valgud 3. Kuidas kaasasündinud i. nakkuse ära tunneb? Nii selgrootutel kui ka selgroogsetel on nn Pattern Recognition Proteins (PRR), mis tunnevad ära patogeenidele omaseid molekulaarseid struktuure (Pathogen associated molecular patterns- PAMP). PAMP on kindlad molekulid ja struktuurid, mida leidub vaid prokarüootidel, näiteks LPS, lipoproteiinid ja peptiidoglükaanid. Neid toodavad vaid mikroobid, mis võimaldab kaasasündinud immuunsusel vahet teha oma ja võõra keha vahel. Kaasasündinud immuunsusel on omased spetsiifilised retseptorid, mis on hästi konverseerinud. Näiteks: Toll-like retseptor, mis talitleb samamoodi nii putukatel kui ka imetajatel. Tunneb ära kindlale patogeenile omaseid molekule
mother's perceived attitudes about life. The mother's emotions, such as fear, anger, love, hope among others, can biochemically alter the genetic expression of the offspring. Our perceptions of the environment, and their attendant emotions, elicit physiological responses in the body by releasing "signal" molecules into the blood. Blood-borne emotion-related signals activate specific receptor proteins on the surfaces of cells in tissues and organs. Activated receptors serve as molecular switches that adjust the metabolic system and behavior of the organism, so as to accommodate environmental challenges. Physiologic responses to environmental signals include regulations of the nervous system, endocrine organs, and the cardiovascular, respiratory, digestive and excretory functions. During pregnancy, the parent's perception of the environment is chemically communicated to the fetus through the placenta, the cellular barrier between the maternal and fetal blood. The
redigeerimine jne. d. Leida nukleotiidide sisaldused, ORF-d, komplementaarsed järjestused, restriktsioonikaardid. Transleerida erinevates raamides, leida aminohapete sisaldused, luua erinevaid hüdrofoobsus ja fiilsus profiile. Nukleotiidide sisaldused: DNA molecule: gi|24648965|ref|NM_142773.1| Drosophila melanogaster CG7069-RA (CG7069), mRNA Length = 2693 base pairs Molecular Weight = 818782,00 Daltons, single stranded Molecular Weight = 1636219,00 Daltons, double stranded G+C content = 48,05% A+T content = 51,95% Nucleotide Number Mol% A 880 32,68 C 551 20,46 G 743 27,59 T 519 19,27 ORF: >gi|24648965|ref|NM_142773.1| Drosophila melanogaster CG7069-RA (CG7069), mRNA ATGTTCCACTTGCCTGTTAAACCTAAGATATCGCTGCTATGCCAGCAAATGCAAGAAA
Roheline (taimed) Sinine (vesi) Valge (tööstus) Bioinformaatika 5. Mikroobne toit 6. Inimese kasvuhormoon inimese kasvuhormoon (ingl. Human growth hormone)- Inimese normaalseks kasvuks vajalik signaalne polüpeptiid hüpofüüsist. Inimese mõnede kääbuskasvutüüpide korral on vastav geen defektne. 7. Molekulaarsed tšaperonid molekulaarsed tšaperonid (ingl. Molecular chaperones)- Valgud, mis on abiks rakusiseste makromolekulaarsete struktuuride mittekovalentsel assambleerimisel/deassambleerimisel ja voltumisel/mittevoltumisel, kuid mida ei ole enam normaalse bioloogilise funktsiooniga struktuurides, kus voltumine või assambleerumine on juba toimunud. 8. Ti-plasmiidid, geenide ülekanne taimedel Ti-plasmiid (ingl. Ti plasmid)- Agrobacterium tumefaciens´i ja A.
Rips-epiteelid väljutab mikroobe b. Füsioloogiline i. Temperatuur ii. pH iii. lüsosoomid, iv. PRR c. Fagotsütoos d. Põletikuline patogeen tungib koesse, tekib põletik, kude tursub. Põhjuseks versoonte muutused (läbilaskvamad), eksudaadi teke, fagotsütoos. (kuidas kaasasündinud im. nakkuse ära tunneb) PRR tunneb ära patogeenile omased molekulaarseid struktuure (PAMP pathogen associated molecular patterns) kindlald molekulid ja stukruurid. (N: LPS, lipoproteiini, peptidoglükaanid). PAMPe toodavad vaid mikroobid, seega teeb k.i. vahet omal ja võõral. PRR retseptorid on konserveerunud hästi: a. Toll-like receptor (TLR) tunneb kindlale patogeenide klassile oamsed molekule (LPSi Gr- bakteritel). Kutsutakse esile esmae mittsespets. im. vastus ja põletik; aktiveeritakse dendriitrakud ning viimasena antigeen-septsiifilien vastus.
ApoE teatav haplotüüp (variant) on Alzheimerile väga soodus. Mis siis, et esmapilgul pole üldse seotud sellega. Mittekodeerivad SNPd võivad muuta ekspressioonitaset. Teatud genoomiblokid on konserveerunud SNPde poolest. · Minisekveneerimine: 1 kaupa märgistatud nukleotiidide lisamine. · Reaalaja PCR spetsproovidega, SNPde deletsiooniks. Mõõdetakse fluorestsentsi teket. · Polümeraasipõhine ekstensioonitehnika 17. TaqMan ja Molecular Beacon töötamisprintsiip Homogeensed hübridisatsioonitestid, kasutades reaalaja PCR-i ja fluorostsentsil põhinevat detektsiooni. Põhinevad energia ülekandel, kus fluorestsents detekteeritakse tänu muutusele füüsikalises distantsis fluorokroomi ja vaigistaja vahel pärast proovide hübridisatsiooni. Iga SNP vajab spetsiaalpraimerit. Kõige efektiivsemad väheste SNP-de ja suure hulga proovide puhul. 18. Suure võimsusega genotüpiseerimise võimalused 1
NOD –(Nucleotide oligomerization domain) retseptorid . Üle 20 imetajatel (NOD2-muramüül dipeptiid) RLR retseptorid RNA helikaasid Taimede PPR retseptorid(XA21, FLS2) MBL (mannan-binding lectin) C-reaktiivne valk Komplemendi retseptorid RNA helikaasid RIG-I ja MDA5 RIG-I ja akronüümid immunoloogilistes tekstides RIG-I(retinoic-acid-inducible protein ) retseptorite (tsütosoolsed RNA helikaasid) käivitatud signaalirajad Taimede immuunsüsteemi elemente PAMPS- Pathogen-associated molecular pattern LRR- leucine-rich repeat (leutsiini rikaste kordustega retseptorid) R genes (resistentsuse geenid) RNA interference Lihtsamad keemilised mediaatorid ja signaalnolekulid (salitsüül hape,jasmon hape, etüleen.....) Immuunreaktsioonid taimedel miRNA ssRNA molekule mõnest tuhandest kuni 40,000 molekulini raku kohta Leitud kõigis metazoa liikides, 0.5-1% geenidest siRNA märklauaks on geenid, millest on ise pärit miRNA reguleerib erinevaid geene
But this explosion should not be taken for an increase in knowledge and wisdom, which cannot so easily by measured. What can be said truthfully is that some knowledge is increasing while other kinds of knowledge are being lost. David Ehrenfeld has pointed out that biology departments no longer hire faculty in such areas as systematics, taxonomy, or ornithology. In other words, important knowledge is being lost because of the recent overemphasis on molecular biology and genetic engineering, which are more lucrative, but not more important, areas of inquiry. We still lack the the science of land health that Aldo Leopold called for half a century ago. It is not just knowledge in certain areas that we're losing, but vernacular knowledge as well, by which I mean the knowledge that people have of their places. In the words of Barry Lopez: "[I am] forced to the realization that something strange, if not dangerous, is afoot. Year by year the
mikroobidevastaseid aineid defensiine. Need on positiivse laenguga amfipaatsed peptiidid, mis seostuvad patogeenide membraanidele ja lõhuvad selle. Imetajate rakud toodavad viirusevastaseid tsütokiine – interferooni α ja β, mis peatavad viiruste paljunemise Peremeesorganismi n.n. mustrit äratundvad retseptorid. Toll’i-sarnased retseptorid. Patogeenidele omase molekulaarse mustri (ingl.k. pathogen-associated molecular pattern) tunnevad ära peremeesorganismi n.n. mustrit äratundvad retseptorid (ingl.k. pattern recognition receptors) (paiknevad raku plasmamembraanis või rakusiseselt). Retseptorid kutsuvad esile infeksiooni tekkekohas esile põletiku. Tolli sarnased- paikneb plasmamembraanis Bakterite fagotsüteerimine neutrofiilide poolt. Bakter fagotsüteeritakse neutrofiili poolt, fagosoom eraldab azurofiilsed jaspetsiifilisi
annaabi.ee 
