Vajad kellegagi rääkida?
Küsi julgelt abi LasteAbi
Logi sisse
Sulge

"accession" - 46 õppematerjali

Turkey and the European Union
7
doc

Turkey and the European Union

Tallinn University TURKEY AND THE EUROPEAN UNION Tallinn 2013 INTRODUCTION The accession negotiations and the forthcoming Turkish accession present challenges to both Turkey and the EU. It is widely accepted that Turkey's accession would be different from previous enlargements because of the combined impact of Turkey's population, size, geographical location, economic, security and military potential. The case of Turkey will be different and more challenging from previous accessions for a number of reasons, some of them are presented below. Turkey is a country with a large population and geographic area. With a population of 74 million today, it is projected that it could be the largest member state at the time of

Keeled → Inglise keel
5 allalaadimist
Maaelu arendamise perspektiivid suurenevas Euroopas
13
docx

Maaelu arendamise perspektiivid suurenevas Euroopas

Maaelu arendamise perspektiivid suurenevas Euroopas: Ühise põllumajanduspoliitika ja põllumajandusliku ülemineku mõju uutele Euroopa Liidu liikmesriikidele Sissejuhatus Selle töö eesmärgiks on luua asjakohane teoreetiline raamistik maaelu arendamisega seotud küsimustele suurenevas Euroopas ning analüüsida maaelu arendamise perspektiive Euroopa Liidu (EL) liikmesriikidele 2004. aastal lisandunud riikides. Euroopa Liidu laienemine Kesk- ning Ida-Euroopa(KIE) riikide seas on märkimisväärselt mõjutanud nende põllumajanduse ning maaelu arengu poliitikaid. Üks rohkem vaidlust pakkunud teema seoses EL laienemisega on olnud küsimus, kas liitunud KIE riigid peaksid saama täieliku ligipääsu Ühise põllumajanduspoliitika (ÜPP) toetustele, eriti otsetoetustele ning struktuurifondidele. Hiljutised uuringud hindavad EL-i mõju eelarvekärbetele KIE riikides ning kaubanduses. On üllatav, et maaelu arendamine uutes liikmesriikides on ...

Politoloogia → Euroopa liit
14 allalaadimist
St-James Park
4
docx

St. James Park

St. James Park History St James’s Park is the oldest Royal Park in London. On James I's accession to the throne in 1603, he ordered that the park be drained and landscaped, and kept exotic animals in the park, includingcamels, crocodiles, and an elephant, as well as aviaries of exotic birds along the south. Charles II opened the park to the public, as well as using the area to entertain guests. On his desire had the park redesigned in a more formal style, probably by the French landscaper André Mollet. At the end of the 17th century and early 18th century were the cows

Keeled → British culture (briti...
3 allalaadimist
TRADERUN ANSWERS
3
docx

TRADERUN ANSWERS

benefit and business benefit). 3.Is the purpose of ENP to prepare EU Eastern Partners for the EU membership? Should it be? Bring arguments! For which (if any) of the EaP countries do you see as perspective EU member states? The European Neighbourhood Policy (ENP) is not about membership of the EU. It is a response to long-standing requests from many of these countries for closer relations, founded on partnership and joint ownership. If an accession perspective were to be offered at some point in the future to any of the countries covered by the ENP, this would be a separate process. The main purpose is to develop free trading between EU and Eastern Partnership Countries and develop democratical views in Eastern Partnership Countries. One of the countries which I belive has opportunity some day to join EU is Moldova. The Republic of Moldova actively pursues EU membership, but it is poorer than any other European country

Politoloogia → Rahvusvahelised suhted
5 allalaadimist
Presentatsioon Buckinghami palace ist
7
ppt

Presentatsioon Buckinghami palace'ist.

popular landmarks in United Kingdom. It is the London home for the royal family. Every year, over 50 000 invited guest are enertained at garden parties, receptions, and banquets . History of Buckingham Palace Buckingham palace was originally built for Duke of Buckingham in 1703 but later it was acquired by George lll in 1761 as a private resident. Buckingham Palace finally became the official royal palace of the British monarch on the accession of Queen Victoria in 1837. Inside of the palace.. The palace contains 77,000 square metres of floorspace. It also includes music room, green and white drawing room, gallerys, many bedrooms, suits and many more rooms. GREEN DRAWING ROOM WHITE DRAWING ROOM Today.. Buckingham Palace is still one of the most beautiful palaces in UK

Keeled → Inglise keel
18 allalaadimist
Introduction tallinnasse
1
docx

Introduction tallinnasse

As an important port for trade between Russia and Scandinavia, it became a target for the expansion of the Teutonic Knights and the Kingdom of Denmark. Historically, the city has been attacked, sacked, razed and pillaged on numerous occasions. Although extensively bombed by Soviet airforces during the latter stages of World War II, much of the medieval Old Town still retains its charm. Since independence, improving air and sea transport links with Western Europe and Estonia's accession to the European Union have made Tallinn easily accessible to tourists. SIGHTSEEING The main attractions are in the two old towns, Lower Town and Toompea, which are both easily explored on foot. Eastern districts around Pirita and Kadriorg are also worth visiting and the Estonian Open Air Museum near Rocca al Mare, west of the city, preserves aspects of Estonian rural culture and architecture. KADRIORG This is 2 kilometres east of the centre and is served by buses and trams. The former

Keeled → Inglise keel
12 allalaadimist
The most important key dates in Estonian history
1
doc

The most important key dates in Estonian history

Estonia is annexed to Soviet sphere of influence 1945-1991 ­ Soviet occupation 1988 ­ Activities of Popular Front and the Singing Revolution 19-21 August 1991 ­ coup d'état in Soviet Union 20 August 1991 ­ Estonia declares independence and is recognised by about 40 countries. 1992 ­ New constitution is adopted, money reform, Estonia is admitted to Council of Europe 1997 ­ European Union starts accession negotiations 2004 ­ Estonia becomes a member of EU and NATO I think that the history of Estonia is richer in different rulers than some other country's history and the influence of these cultures can still be seen in our modern Estonia.

Keeled → Inglise keel
7 allalaadimist
Planning of Cultural Landscapes
17
ppt

Planning of Cultural Landscapes

Tallinn and the richest in various species. One of the most important event of foreign policy took place in Kadriorg PalaceThe important men of Russia and Austria discussed the possibilities of destroying Prussia. One of the most important visitor from Russia in Kadriorg was Katarina II. On June 28 1764, a fancydress ball took place in the Kadriorg Palace for about five hundred persons,dedicated to the celebration of the anniversary of Katarina II´s accession(astumine) to the throne. 1908.on July 15 the greece crown princess Alice came to see Tallinn.She was only few days in here but still loved it. The first trip through the air in Estonia that was done with the balloon by Mr.Berg who had come here from St.Peterburg.he managed to rise about 1500 metres from the surface.A lot of people,who were with him in the air were frightened,so after an hour they landed far away in Lasnamäe. Kersti Lootus.Kadriorg today

Keeled → Inglise keel
7 allalaadimist
Kadriorg Park
1
doc

Kadriorg Park

Kadriorg Park which celebrated its 293th birthday on July 22 is the largest park in Tallinn and the richest in various species. One of the most important event of foreign policy took place in Kadriorg Palace-The important men of Russia and Austria discussed the possibilities of destroying Prussia. On June 28 1764, a fancy-dress ball took place in the Kdriorg Palace for about five hundred persons,dedicated to the celebration of the anniversary of Katarina II´s accession(astumine) to the throne. 1908.on Jluy 15 the greece crown princess Alice came to see Tallinn.She was only few days in here but still loved it. The first trip through the ai rin Estonia that was done with the balloon by Mr.Berg who had come here from St.Peterburg.he managed to rise about 1500 metres from the surface.A lo of people,who were with him in the air were frightened,so after an hour they landed far away in Lasnamäe. Kersti Lootus.Kadriorg today Landscapes architect.

Keeled → Inglise keel
12 allalaadimist
House of Winsdor
2
docx

House of Winsdor

in the First and Second World Wars, ending up on the winning side both times, but subsequently lost its status as a superpower during decolonisation. Much of Ireland broke with the United Kingdom and the remnants of the Empire became the Commonwealth of Nations. King George V (1865-1936), Reigned 1910-36 As the second son of King Edward VII and Queen Alexandra, George V had not expected to ascend to the throne. He enjoyed a long and successful career in the Navy before his accession in 1910. His conscientious and unpretentious approach to his duties provided stability during an unsettled period, which included the First World War and the Great Depression. In 1932, he became the first monarch to use the medium of radio to speak to the nation. He later described himself as `a very ordinary sort of fellow'. Prince Edward, Duke of Windsor (King Edward VIII) (1894-1972), Reigned 1936 Eldest son of George V and Queen Mary. Prince Edward was commissioned into the

Keeled → Inglise keel
2 allalaadimist
Küberkaitse
18
pptx

Küberkaitse

EXCELLENCE The Centre was established on 14 May 2008, it received full accreditation by NATO and attained the status of International Military Organisation on 28 October 2008. The Centre conducts Located Tallinn Filtri tee 12 , Estonia research and training on cyber security and includes a http://www.kmin.ee/et/nato-kuberkaitsekeskus- staff of approximately 40 tallinnas HISTORY • In 2003, prior to the country’s official accession to NATO, Estonia proposed the creation of a "cyber excellence center". The 2006 Riga summit listed possible cyber attacks among the asymmetric threats to the common security and acknowledged the need for programs to protect information systems over the long term. The cyber attacks on Estonia in 2007 highlighted for the first time the potential vulnerability of any NATO countries, their institutions and societies, and even NATO itself to disruption or penetration of their

Ühiskond → Ühiskonnaõpetus
11 allalaadimist
Sandrigham house
3
doc

Sandrigham house

the gentry, for the farmer and for the servants. One of the main activities at Sandringham was shooting. The Prince of Wales liked to be outdoors as much as possible and he devised the idea of ST - Sandringham Time. The idea was to make the most of the winter daylight hours for his passion for shooting and so the clocks all over the Sandringham Estate were advanced by half an hour. King George V maintained this custom during his lifetime, but King Edward VIII abolished it on his accession in 1936. Sandringham was the setting for some dramatic events. Queen Victoria did not pay her first visit to Sandringham until 1871, when the Prince of Wales suffered an attack of typhoid fever (the illness of which his father had died) while staying there. Margus Maasik G1a To the relief of Queen Victoria and the nation, the Prince survived and made a slow recovery. The eldest son of the Prince and Princess of Wales was not so lucky 21 years later. Prince

Keeled → Inglise keel
7 allalaadimist
Tallinn-general overview
12
odp

Tallinn, general overview

understood in Tallinn. Russian is also widely spoken as a native language. Ethnic composition (2009) Nationality Percentage Estonians 52.2% Russians 38.6% Ukrainians 3.8% Belarusians 2.1% Finns 0.6% Others 2.7% Coat of arms and flag of Tallinn Tourism Since independence, improving air and sea transport links with Western Europe and Estonia's accession to the European Union have made Tallinn easily accessible to tourists. The main attractions are in the two old towns (Lower Town and Toompea) which are both easily explored on foot. Eastern districts around Pirita and Kadriorg are also worth visiting and the Estonian Open Air Museum (Eesti Vabaõhumuuseum) in Rocca al Mare, west of the city, preserves aspects of View of Oleviste church tower International relations

Keeled → Inglise keel
13 allalaadimist
Queen Mary I of England
2
doc

Queen Mary I of England

When her father died, she was second in line to the throne, after her half-brother Edward, who was physically weak. 3.SLAID In 1533 when Edward died another rival was put forward- her cousin Lady Jane Grey who supported Protestantism. Public sympathy remained with Mary, and she soon overcame resistance to her accession. . Mary first began to earn her unofficial title of "Bloody Mary" when she had her cousin executed to prevent any possible power struggle Mary tried to turn England back to Roman Catholicism. This effort was carried out by force, and hundreds of Protestant leaders were executed. The first was John Rogers the printer of the "Matthews-Tyndale Bible"

Keeled → Inglise keel
7 allalaadimist
Eesti ajalugu
1
doc

Eesti ajalugu

operation and control of its telecommunications facilities, thereby offering the West a clear view into the latest coup developments and serving as a conduit for swift Western support and recognition of Estonia's "confirmation" of independence on August 20, 1991. August 20 remains a national holiday in Estonia because of this. Since the last Russian troops left in 1994, Estonia has been free to promote economic and political ties with Western Europe. Estonia opened accession negotiations with the European Union in 1998 and joined in 2004, shortly after becoming a member of NATO.

Ajalugu → Maiskonnalugu
10 allalaadimist
BUCKINGHAM PALACE
2
docx

BUCKINGHAM PALACE

It was built for the Duke of Buckingham in 1703 on a site which had been in private ownership for at least 150 years. It was subsequently acquired by George the third in 1761 as a private residence for Queen Charlotte and known as The Queen's House. During the 19th century it was enlarged, principally by architects John Nash and Edward Blore, forming three wings around a central courtyard. Buckingham Palace finally became the official royal palace of the British monarch on the accession of Queen Victoria in 1837. The last major structural additions were made in the late 19th and early 20th centuries.Buckingham Palace is 108 metres long across the front, 120 metres deep (including the quadrangle) and 24 metres high. The total floor area of the Palace, from basement to roof, covers over 77,000 square metres.Buckingham Palace has 775 rooms. These include 19 State rooms, 52 Royal and guest bedrooms, 188 staff bedrooms, 92 offices and 78 bathrooms. There are 1,514 doors and 760

Keeled → Inglise keel
7 allalaadimist
Queen Elizabeth I lifestory
17
pptx

Queen Elizabeth I lifestory

Mary's initial popularity ebbed away government, including Lord Paget. when it became known that she planned On 22 May, Elizabeth was moved to marry Prince Philip of Spain. from the Tower to Woodstock, where Discontent spread rapidly through the she was to spend almost a year under country, and many looked to Elizabeth house arrest in the charge of Sir as a focus for their opposition to Mary's Henry Bedingfield. religious policies. Accession Elizabeth became queen at the age of 25, and upon hearing of her accession to the throne, she is reputed to have quoted the As her triumphal progress wound 118th Psalm's twenty-third line, through the city on the eve of the in Latin: "A Domino factum est coronation ceremony. illud, et est mirabile in oculis Elizabeth's open and gracious responses endeared her to the spectators.

Ajalugu → British history (suurbritannia...
14 allalaadimist
Tallinn
3
doc

Tallinn

Tallinn became the capital of an independent Estonia. After World War II started, Estonia was occupied by the Soviet Union (USSR) in 1940, and later occupied by Nazi Germany from 1941-44. After Nazi retreat in 1944, it was occupied by the USSR again. After that Tallinn became the capital of the Estonian SSR. Tallinn's population is registered 400,200 (as of May 2007). Since independence, improving air and sea transport links with Western Europe and Estonia's accession to the European Union have made Tallinn easily accessible to tourists. Estonia has made rapid economic progress since independence and this is reflected in local prices. Although not extortionate, neither are prices as cheap as in other former Eastern Bloc countries. The main attractions are in the two old towns (Lower Town and Toompea) which are both easily explored on foot. Eastern districts around Pirita and Kadriorg are also worth visiting and the

Keeled → Inglise keel
6 allalaadimist
Hiina
6
doc

Hiina

The reforms replaced collectivization of Chinese agriculture with privatization of farmlands, increased the responsibility of local authorities and industry managers, allowed a wide variety of small-scale enterprises to flourish, and promoted foreign investment. Price controls were also relaxed. These changes resulted in mainland China's shift from a planned economy to a mixed economy. China became a member of the World Trade Organization in 2001.[55] China's accession into the World Trade Organization (WTO) was a goal achieved after nearly fifteen years of exhausting negotiations carrying many legal, political and social implications for all parties. China was finally able to convince WTO members that without China, the WTO is only partially a worldwide trade organization. The road to the signature of the final agreement of accession was long, but these difficulties pale in comparison to the problems that have not yet been tackled in terms of achieving

Geograafia → Geograafia
49 allalaadimist
Joogiveekriis Maailmas
3
docx

Joogiveekriis Maailmas

globaalne, regionaalne, siseriiklik ja kohalik) inimkond püüab säästa vett, siis maailmas suureneb puhta vee kogus. Kasutatud kirjandus: 1. Unicef and World Health Organisation, 2012, Progress on Drinking Water and Sanitation: 2012 Update, WHO Library Cataloguing-in-Publication Data, ISBN: 978-92-806-4632-0 (NLM classification: WA 670), 2-63. 2. Vaux Jr., Henry, 2012, Water for agriculture and the environment: the ultimate trade-off., ISSN: 13667017, accession number: 74564952. 3. Frumin, G.T., 2007, "DIRECTIONS OF PERFECTION OF WATER SUPPLY IN THE COUNTRIES OF THE ARABIAN PENINSULA» , Russian state hydrometeorological university,Number 6, part 2. 1-5. 4. Globaalprobleemid, 2011, Veekriis ja veekogude reostumine, Kättesaadav: http://www.miksike.ee/documents/main/referaadid/globaalprobleemid2.htm

Loodus → Keskkond
15 allalaadimist
London History
3
doc

London History

and artistic achievement. 1. In ex. 2 at page 19 you have to read and translate the words from the text and divide them into 4 groups according to their word-stress. I ­ swamp, Celtic, devastate, province, fort, hostile, reign, flourish, mighty, grant, charter, citizen, secular, turbulent, costly, claim, breach, fourfold, filth, era. II ­ inhabitant, basilica, defence, withdraw, invade, decisive, accession, succeed, disaster, erect, achievement. III ­ occupation, influential, execution, restoration. IV ­ ecclesiastical. 2. In ex. 3 at page 20 you had to find some information about those famous people. Alfred the Great (reigned 871-899) ­ Saxon king, a learned man, chose London to be the capital of the country. Edward the Confessor (1042-1066)­ a weak English king, more interested in ecclesiastical matters, founded Westminster Abbey, wanted to unificate Britain.

Keeled → Inglise keel
5 allalaadimist
The Queens of England
4
doc

The Queens of England

Diana's death, however, sparked much debate on the role of the monarchy, its perceived lack of "popular" touch, the formality of its institutions, and its size in terms of the number of royals with public duties. In November 1999 Australia voted in a referendum to retain their country's constitutional monarchy, thus maintaining Australia's ties with Britain. Elizabeth visited the country in 2002 during her tour of Commonwealth countries to mark the golden jubilee of her accession to the throne; a year also marked by the deaths of her mother, and sister Margaret. It is estimated that two million people attended the Golden Jubilee celebrations around Buckingham Palace, which included concerts and fireworks, in June.

Keeled → Inglise keel
14 allalaadimist
EU COOPERATION WITH RUSSIA AND EASTERN
4
docx

EU COOPERATION WITH RUSSIA AND EASTERN

2. Evaluate the policy motivation of the ENP ­ is the conditionality for the EU's benefit, partner country's benefit, for mutual benefit, or business benefit? Bring at least three (3) specific examples. 3. Is the purpose of ENP to prepare EU Eastern Partners for the EU membership? Should it be? Bring arguments! For which (if any) of the EaP countries do you see as perspective EU member states? 4. Which are the areas of cooperation and evaluation in the ENP that overlap with the EU accession criteria? Which are the fields that the ENP does not cover and only Copenhagen Criteria assesses? 5. Which are the most updated EU documents to describe ENP and EaP policy goals and tools? https://moodle.ut.ee/file.php/1219/2dets_Traderun_ENP_2011.pdf http://www.epl.ee/news/eesti/article.php?id=51163525 http://eeas.europa.eu/delegations/russia/eu_russia/chronology/index_en.htm http://en.wikipedia.org/wiki/Russia%E2%80%93European_Union_relations#Trade http://trade.ec.europa

Politoloogia → Rahvusvahelised suhted
8 allalaadimist
The euro in Estonia
5
doc

The euro in Estonia

The main goal of this union is to assure uncommitted movement of citizens, commodities, services and capital. The first usage of euro (as an electronical currency) was in 1999 within banks and enterprises. In 2002 first bank-notes came into money-traffic. The whole value of issued euro coins and notes is over 704 billion euros. In 1995 on 25th November Estonian prime minister Tiit Vähi signed the Kati-Liis Karu 03.01.2011 application, which requested the accession of Estonia into the European Union. As mentioned before, Estonia joined the European Union in 2004. When "we" signed the contract, we also accepted the simple main terms: stable institutions, that can guarantee the democracy and the protection and respect of human rights and minorities; a functioning market economy and the ability to cope with the pressure of competition and market forces within the EU;

Keeled → Äriinglise keel
13 allalaadimist
My Town
4
doc

My Town

the newcomers. Tallinn was the biggest grain-handling port in the Soviet Union. Russian speakers out- numbered Estonians in Tallinn. Estonia re-established its independence on 20 August 1991. There is still a large block of granite on Toompea which recalls the days when people barricaded Lossiplats (Castle Square) to prevent Soviet tanks gaining access. Modern Tallinn and places to visit. Since independence, improving air and sea transport links with Western Europe and Estonia's accession to the European Union have made Tallinn easily accessible to tourists. The picturesque old town, a UNESCO World Heritage Site, and the current novelty of the destination attract many tourists and facilities (hotels, restaurants) have developed to meet their needs. English is widely spoken within the tourist areas. Note that Estonia has made rapid economic progress since independence and that this is reflected in local prices. Although not extortionate, neither are prices as

Keeled → Inglise keel
5 allalaadimist
Londoni ajalugu Rooma - 20 sajand
7
doc

Londoni ajalugu Rooma - 20 sajand

Originally known as, the building which forms the core of today's palace was a large townhouse built for the Duke of Buckingham in 1703 on a site which had been in private ownership for at least 150 years. During the 19th century it was enlarged, principally by architects John Nash and Edward Blore, forming three wings around a central courtyard. Buckingham Palace finally became the official royal palace of the British monarch on the accession of Queen Victoria in 1837. · Harrods is London's most famous department store, is named after Charles Henry Harrod, who opened a family grocers shop on the site in 1849. The store occupies a 5-acresite and has over one million square feetof selling space in over 330 departments .

Keeled → Inglise keel
6 allalaadimist
Kodutöö word variant 9 teema 19
18
docx

Kodutöö word variant 9 teema 19

apparatus for crushing opposition, suppressing criticism, and furthering colonial economic exploitation as well as intensifying book censorship and consolidating personal control and profit. NATIONAL AND IMPERIAL CHANGE The new ruler, Queen Maria I of Portugal, disliked the Marquis because of the power he amassed, and never forgave him for the ruthlessness at which he dispatched the Távora family, and upon her accession to the throne, she withdrew all his political offices. Pombal died on his estate at Pombal in 1782. In the autumn of 1807, Napoleon moved French troops through Spain to invade Portugal. From 1807 to 1811, British-Portuguese forces would successfully fight against the French invasion of Portugal, while the royal family and the Portuguese nobility, including Maria I, relocated to the Portuguese territory of Brazil, at that time a colony of the Portuguese Empire, in South America

Informaatika → Informaatika
22 allalaadimist
Estonia topic
6
doc

Estonia topic

and of NATO since 29 March 2004 Estonia has also signed the Kyoto protocol. Economy Estonian economy was one of the fastest growing in the world until 2006 with growth rates even exceeding 10% annually. Despite some concerns both in and outside of the country, the Estonian economy and its currency remained highly resilient and solvent. Until recent years the Estonian economy continued to grow with admirable rates. Estonian GDP grew by 6.4% in the year 2000 and with double speeds after accession to the EU in 2004. The GDP grew by 7.9% in 2007 alone. Increases in labor costs, rise of taxation on tobacco, alcohol, electricity, fuel, and gas, and also external pressures (growing prices of oil and food on the global market) are expected to raise inflation just above the 10% mark in the first months of 2009. In the first quarter 2008 GDP grew only 0,1%. The government made a supplementary negative budget, which was passed by Riigikogu. The revenue of the

Keeled → Inglise keel
47 allalaadimist
Fiskaalpoliitika ehk eelarvepoliitika
8
pdf

Fiskaalpoliitika ehk eelarvepoliitika

"Fiscal Reform Over Ten Year of Transition", IMF WP, No 113, 2000. 15. Vihanto, M. "Tax Evasion in a Transition from Socialism to Capitalism: The Psychology of the Social Contract", BOFIT Discussion Papers, No 6 , 2000. 17. Viren, Matti. "Fiscal Policy Coordination in EMU", A Political Backlash against the Market Economy, The Centre for Finnish Business and Policy Studies, Helsinki, 1999. 79 18. Weber, R., Taube, G. "On the Fast Track to EU Accession: Macroeconomic Effect and Policy Challenges for Estonia", IMF WP, No 156, 1999. 19. World Economic Outlook (WEO): Progress with Fiscal Reform in Countries in Transition, IMF, October 1998. 20. World Economic Outlook (WEO): World Economic Outlook and Policy Responses to the the Global Slowdown, IMF, May 1999. 21. World Economic Outlook (WEO): Transition: Experience and Policy Issues, IMF, 2000. Summary SOME ASPECTS OF ESTONIAN FISCAL POLICY

Ajalugu → Ajalugu
120 allalaadimist
Kaasaegse avaliku teenistuse olemus ja arengud
26
pdf

Kaasaegse avaliku teenistuse olemus ja arengud

A Small Civil Service in Transition: The Case of Estonia. Public Administration and Development (21), lk 41-51. 11. Reinsalu, S.; Tõniste, M. (2009). Uue avaliku teenistuse seaduse eelnõu lähtekohad. Avaliku teenistuse aastaraamat. Tallinn: Riigikantselei. 12. SIGMA (1999), European Principles for Public Administration. SIGMAPaper 27. Paris: OECD/SIGMA. 13. SIGMA (2009). Sustainability of Civil Service Reforms: Central and Eastern Europe Five Years after EU Accession. SIGMA Paper 44. Paris: OECD/SIGMA). 14. Vabariigi Valitsus. Riigireform. Arvutivõrgus: https://valitsus.ee/et/riigireform (01.01.2016). 12

Ühiskond → Ühiskond
16 allalaadimist
Mageveekäsna Ephydatia fluviatilis populatsiooni geneetiline analüüs
12
pdf

Mageveekäsna Ephydatia fluviatilis populatsiooni geneetiline analüüs

assessment can be made. Data Access The results from three parallel PCR amplifications with 100 ng The sequences of the clones have been submitted to the NCBI of DNA from the same extraction, conducted in same conditions, GenBank (http://www.ncbi.nlm.nih.gov/) under accession num- showed a variance of less than 1% for the ITS1 length analysis bers KC243990­KC244049. (Table 1), which is far less than the permitted error rate of 5% (established from clone sequencing results), and a variance of 2%

Bioloogia → Eesti loomad
1 allalaadimist
Challenges of childrens participation A Case Study of active citizenship in Cadle Primary School
164
docx

Challenges of childrens participation A Case Study of active citizenship in Cadle Primary School

(2009), http://wales.gov.uk/docs/dcells/publications/091117gettingitrighten.pdf [accessed 16 April 2014] Welsh Government, Tackling Poverty Action Plan 2012-2016, http://www.rctcbc.gov.uk/en/relateddocuments/publications/communitiesfirst/tackling- poverty-action-plan.pdf [accessed 5 May 2014] 41 Appendix 1 Convention on the Rights of the Child Adopted and opened for signature, ratification and accession by General Assembly Resolution 44/25 of 20 November 1989 entry into force 2 September 1990, in accordance with Article 49 Preamble The States Parties to the present Convention, Considering that, in accordance with the principles proclaimed in the Charter of the United Nations, recognition of the inherent dignity and of the equal and inalienable rights of all members of the human family is the foundation of freedom, justice and peace in the world,

Keeled → Inglise keel
7 allalaadimist
Finland
11
odt

Finland

exports to the United States. About 2.3% of the Finnish GDP comes from exports to the United States. Except for timber and several minerals, Finland depends on imported raw materials, energy, and some components for its manufactured products. Farms tend to be small, but farmers own sizable timber stands that are harvested for supplementary income in winter. The country's main agricultural products are dairy, meat, and grains. Finland's EU accession has accelerated the process of restructuring and downsizing of this sector. (www.state.gov) 5 The people The `Nordic` image of a person with blond hair and blue eyes is quite a rare sight on Finalnd; most of the population is dark-haired. This is because of the Finns` ancestry: the people who moved into the southwestern corner of today`s Finland from Estonia via the

Majandus → Majandus
12 allalaadimist
Saudi-Araabia
18
doc

Saudi-Araabia

United Nations (UN) United Nations Conference on Trade and Development (UNCTAD) United Nations Educational, Scientific, and Cultural Organization (UNESCO) United Nations Industrial Development Organization (UNIDO) Universal Copyright Convention (UCC) Universal Postal Union (UPU) World Customs Organization (WCO) World Health Organization (WHO) World Intellectual Property Organization (WIPO) World Meteorological Organization (WMO) World Trade Organization (WTO) Accession negotiations underway Rahvaarv, selle muutumine ja Rahvastikupüramiid Saudi-Araabia on keskmise suurusega riik. Rahvaarv on 28,146,656 inimest. Rahvarvu muutumine: 2000 aastal- 20,660,700 2001 aastal- 21,122,700 2002 aastal- 21,589,240 2003 aastal- 22,054,280 2004 aastal- 22,529,340 2005 aastal- 23,118,990 2006 aastal- 23,680,640 2007 aastal- 27,601,038 2008 aastal- 28,146,656 Linnades elavate inimeste arv: Riyadh- rahvaarv 4 700 000 Jeddah- rahvaarv 3 400 000

Geograafia → Geograafia
37 allalaadimist
Õigusalase inglise keele sõnad väljendid eesti keelse tõlkega-units 12-18
11
docx

Õigusalase inglise keele sõnad/väljendid eesti keelse tõlkega (units 12-18)

78. voidable ­ which can be made not legally valid or not having any legal effect 79. building lease = right of superficious ­ hoonestusõigus 80. pre-emptive right ­ ostu-eesõigus (right of first refusal to purchase sth before it is sold to someone else) 81. right of security ­ pandiõigus 82. delivery ­ üleandmine 83. occupation ­ hõivamine 84. finding ­ leid 85. treasure ­ peitvara 86. specification ­ ümbermuutmine 87. confusion ­ segamine 88. accession ­ ühendamine 89. prescription ­ igamine 90. natural fruit ­ loodusvili 91. mercantile law ­ äriõigus 92. tax law ­ maksuõigus 93. corporal objects ­ kehalised esemed 94. establish a right ­ õigus seadma 95. transfer a right ­ õigust üle andma 96. modify a right ­ õigust muutma 97. extinguish a right ­ õigust lõpetama 98. protection against infringements by third parties ­ kaitse rikkumiste vastu kolmanda isiku poolt 99. parties to an obligation ­ kohustuse osapooled

Keeled → Inglise keel
28 allalaadimist
Topic - Estonia
8
doc

Topic - Estonia

On August 23. 1989, Estonians, Latvians and Lithuanians joined their hands to form a 530 km long Baltic Chain connecting the three Baltic capitals. The independence was restored on August 20, 1991. This time is called the Singing Revolution. The last Soviet troops left in 1994. Since regaining independence Estonia has pursued a policy of co-operation with Western Europe. In December 2002, Estonia took part in EU accessing negotiation with nine other countries. The Accession Treaty was signed on 16 April, 2003 with May 1, 2004 the formal entry date. EU enlargement meant the unification of twenty-five countries after over half a century of political division and the "Cold War" which followed WW II. 15.Government Estonia has parliamentary democracy with three branches of power: legislative, executive and judicial. The legislative power is in the hands of parliament, or, as we call it in Estonia: the Riigikogu (or State Assembly). The parliament consists of

Keeled → Inglise keel
70 allalaadimist
Prague praha
18
doc

Prague(praha)

(Czech) "Where is my home?" 5 Figure2. European map. Location of Czech Republic (green) - on the European continent (light green & grey) - in the European Union (light green). Capital (and largest city) Prague (Praha). Official language(s) Czech, Slovak. Government Parliamentary republic. President Václav Klaus. Prime Minister Jan Fischer. EU accession 1 May 2004. Total area- 78,866 km2 (116th). 30,450 sq mi. Water 2%. Population 2009 estimate 10,506,813 (78th)- 2001 census 10,230,060. Density- 132/km2 (77th). 341/sq mi. Calling code +420. HISTORY The recent past Despite the city's turbulent history, Prague's progress in recent years has been more stately than revolutionary. The booming tourism sector and a solid industrial base have left its citizens in better economic shape than the rest of the country. Unemployment is minimal, the

Keeled → Inglise keel
10 allalaadimist
Suurbritannia ühiskond ja kultuur konspekt
14
doc

Suurbritannia ühiskond ja kultuur konspekt

12.French influence on the English language English language originally sprang from the dialects of three Germanic tribes known by historians as the Angles, Saxons, and Jutes. These peoples settled in Britain around 450 AD. Their language became known as Anglo-Saxon. One of the most important influences ever to shape the English language arrived in 1066 AD-William the Conquerors invasion of the British Isles. The Norman Conquest and its Consequences On William the Conqueror's accession to the throne of England, several important changes took place. Firstly, the French dialect the Normans spoke (Anglo-Norman) became the official language of the court, administration, and perhaps just as importantly, the language of culture. At the same time, English was relegated the common people, and became the language of everyday use. This official ignoring of Old English actually assisted in simplifying the language. Being ignored by grammarians,

Kultuur-Kunst → Suurbritannia ühiskond ja...
72 allalaadimist
Inglise keelt kõnelevate maade ajalugu lühikonspekt
168
odp

Inglise keelt kõnelevate maade ajalugu lühikonspekt

United Scotland became known as Kingdom of Alba For two C-s Scotland developed under Pictish rule Malcolm III Canmore and Queen Margaret He was the king of Scotland He married to Margaret of the house of Wessex, whose favour secured Anglo-Norman secular They had several children Queen Margaret became a saint Malcolm fought wars against the Kingdom of England, had to acknowledge the overlordship of the English King Malcolm´s accession to the throne is the The Anglo-Norman invasion of Scotland Queen Margaret invited the Anglo-Normans to settle in They gave the Scottish king some land, anglo- normans pledged loyalty to that They established themselves in Scotland and built castles where Scottish kings would hide in trouble Some Scottish nobles came to live under The English King The Scottish Wars of independence 1286-1371

Keeled → Inglise keel
15 allalaadimist
Ingliskeelsete maade ühiskond ja kultuur-eksamiküsimused
26
docx

Ingliskeelsete maade ühiskond ja kultuur, eksamiküsimused

Commonwealth, he had no crown. By the time Cromwell died, he, his system of government, and the puritan ethics that went with it (theatres and other forms of amusement had been banned) had become so unpopular that the executed king’s son was asked to return and become King Charles II. 18. The Restoration. Restoration, in English history, is the reestablishment of the monarchy on the accession (1660) of Charles II after the collapse of the Commonwealth (see under commonwealth) and the Protectorate. The term is often used to refer to the entire period from 1660 to the fall of James II in 1688. 19. The Whigs and Tories. Within Parliament, the tensions and disagreements of the Civil War and its aftermath were echoed in the formation of two vaguely opposed, loose collections of allies. One group, the Whigs, were the political “descendants” of the

Keeled → Ingliskeelsete maade ühiskond...
14 allalaadimist
Public International Law is a system of law
47
docx

Public International Law is a system of law

the treaty, then when the final document was done, the representative signed the treaty. But it was not the final agreement. Then later the kings looked through the treaty and if he agreed then he signed it as well. Nowadays, serious treaties should be supported by the country therefore it should be ratified by the parliament or by referendum. Accession Could be a one-stage or two-stage procedure. If treaty is a serious one, then two stages are required: 1) signature, 2) ratification, accession etc. Exchange or deposit of instruments of ratification, acceptance, approval, accession Unless the treaty provides otherwise, instruments of ratification, acceptance, approval or accession establish the consent of a state to be bound by a treaty upon their exchange

Keeled → Inglise keel
7 allalaadimist
BRITISH NATIONAL SYMBOLS
72
doc

BRITISH NATIONAL SYMBOLS

with the Union Jack in the canton) used by the Royal Navy. The Royal Standard displaying two quarters of three golden lions on red and two quarters, one with the Irish golden harp on blue and the other with the Scottish rampant red lion on yellow, ought to be mentioned as the design is the same as that of the national arms. The Royal Standard is the flag of the head of state and the banner refers to the monarch's arms of dominion (excluding Wales). Its present form has been dated back to the accession of Victoria as Queen of the Kingdom of Great Britain and Ireland, on June 20,1837. (Stilling, 1995) No other flags in British flag history have ever rivalled the Union Jack. The flag began as a distinguishing flag of a ship, as an auxiliary of the principal flag, and evolved into the main flag of Britain and its empire. Today the Union Jack is flown for government and military purposes and, at sea, as the flag of the Royal Navy. It is also used by the public

Keeled → British culture (briti...
8 allalaadimist
BIOinformaatika kodutöö 5
79
doc

BIOinformaatika kodutöö 5

AAAGAGA AAGGGAGCTAGCTGAAATGGAAAACAAATGGAAACAGGTTGCGGAGAAAAGAAAGAGAAAGAAG GCAGCA GAGATGTGCAGGAAAATAGAGGATGCAAAAGAAAAAGCCGCGGCAGAATCGGCTGATAAGATTCT GAAAG CTGTGTGCGAAAAACTAAAGCAATCTCTCTCGGATCCGGACAAATCAAAAAAGGGCAAGAAATAA AGTGA AAGCTAATGGCAGATTTATATGGAACATTTTAACTTTTAATACGGTGTTACACACCGAATTCCAAAT TAT TATATAAAACTATTGGAATTTTTTAAATTTTCT GenBank formaat: LOCUS NM_142773 2693 bp mRNA linear INV 12-OCT-2006 DEFINITION Drosophila melanogaster CG7069-RA (CG7069), mRNA. ACCESSION NM_142773 VERSION NM_142773.1 GI:24648965 KEYWORDS . SOURCE Drosophila melanogaster (fruit fly) ORGANISM Drosophila melanogaster Eukaryota; Metazoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Diptera; Brachycera; Muscomorpha; Ephydroidea; Drosophilidae; Drosophila. REFERENCE 1 (bases 1 to 2693) AUTHORS Quesneville,H., Bergman,C.M., Andrieu,O., Autard,D., Nouaud,D., Ashburner,M. and Anxolabehere,D.

Informaatika → Bioinformaatika
46 allalaadimist
Sissejuhatus inglise õiguskeelde
35
docx

Sissejuhatus inglise õiguskeelde

Under which law was he punished? /What law he was punished under? ­ milled seaduse järgi teda karistati? Legislators ­ seadusetegijad He filed the claim with the court ­ ta esitas kohtule nõude To amend ­ muutma, parandama Substantial law ­ materiaalõigus Head of state ­ riigipea (really safe to use everywhere) Procedural law ­ menetlusseadus Unicameral ­ ühekambriline (parlament) Legislative authority/power ­ legislatiivjõud Convene ­ kokku kutsuma Accede ­ ühinema, liituma Accession treaty ­ ühinemisleping Eligible ?­ valitav mingile kohale Ineligible? ­ ei saa valida seda inimest Extraordinary elections ­ erakorralised valimised Regular elections - ? Chancellor of justice - õiguskantsler Larceny, theft ­ vargus Adopt a law ­ seadust vastu võtma Case law systems ­ kohtuasi; kohtulahend ???? Court ruling ­ kohtuniku tehtud otsus Statute ­ statuut To administrate law ­ seaduste/õiguste tagamine, Civil disputes ­ tsiviilvaidlus

Keeled → Inglise õiguskeel 1
268 allalaadimist
Euroopa Liidu alused
44
doc

Euroopa Liidu alused

positsioondokument heaks valitsuse või vastava ministrite komisjoni tasandil. Ent sellegi dokumendi puhul võib EL veel vajadusel selgitada poliitilisel tasandil saavutatud üksmeele täpset juriidilist sisu ja vajadusel teha positsioondokumenti redaktsioonilisi parandusi liituja-riigi palvel. Kõige selle protsessi lõpptulemuseks on liitumisleping, mis koosneb ainult kolmest artiklist. Viimase lahutamatuks osaks on sadu lehekülgi hõlmav liitumisakt (Act of Accession). Liitumisdokumentide artiklites ja protokollides on ära toodud primaarõiguse tasandit puudutavad läbirääkimistulemused. EL-i sekundaarõigust puudutavad mugandused on koos üleminekukorraldustega ära toodud liitumisdokumendi lisas. Euroopa Liidu liikmesoleku põhiseaduslikud eeldused Selleks, et suvaline Euroopa riik võiks astuda Euroopa Liidu (EL) liikmeks, peab ta põhiseadus andma võimaluse delegeerida seadusandlik-,

Ühiskond → Ühiskond
14 allalaadimist
Euroopa ideede ajaloo eksami kordamisküsimused
23
doc

Euroopa ideede ajaloo eksami kordamisküsimused

because, he said, the truce stipulated "days," not nights. Not even our own countryman's action is to be commended, if what is told of Quintus Fabius Labeo is true - or whoever it was (for I have no authority but hearsay): appointed by the Senate to arbitrate a boundary dispute between Nola and Naples, he took up the case and interviewed both parties separately, asking them not to proceed in a covetous or grasping spirit, but to make some concession rather than claim some accession. When each party had agreed to this, there was a considerable strip of territory left between them. And so he set the boundary of each city as each had severally agreed; and the tract in between he awarded to the Roman People. Now that is swindling, not arbitration. And therefore such sharp practice is under all circumstances to be avoided. Again, there are certain duties that we owe even to those who have wronged us. For there is a limit to retribution and to

Ajalugu → Ajalugu
11 allalaadimist


Sellel veebilehel kasutatakse küpsiseid. Kasutamist jätkates nõustute küpsiste ja veebilehe üldtingimustega Nõustun