Its main goal is to get at the facts that are general for all of mankind. Psychology hopes to find a route back to understand the individual event. It tries to find explanations to some behaviors and once such explanations are found, they may lead to practical applications; to hel counsel and guide, and perhaps to effect desirable changes. BIOLOGICAL BASES OF BEHAVIOR Any question about bodily movement must inevitably call for some reference to the nervous system, for tu us it is quite clear that the nrevous system is the apparatus which most directly determines and organizes an organisms reactions to the world in which it lives. Rene Descartes and the Reflex Concept: All action was essentially a response to some event in the outside world. Something from the outside excites one of the senses. This transmits the excitation
The most unusual pets Elephant They live in Africa. Her/his body color is gray. Elephant ears have thick bases with thin tips. Elephants usually have 26 theeth. An elephant’s skin is generally very tough. In walking, the legs act as pendulums, with the hips shoulders rising and falling while the foot is planted on the ground.Fast- moving elephants appear to ’run’ with their front legs, but ’walk’ with their hind legs and can reach a top speed of 18 km/h (11mph). Elephants eat massive amounts of food — in the case of the African elephant, as much as 660 pounds¹ in a single day. They communicate by touch, sight, and sound; elephants use infrasound, and seismic communication over long distances. I choosed that animal becose I love this animal and it's so big and strong. MORE INTERESTING ABOUT THIS ANIMAL : Because of their large size, elephants have a huge impact on their environments ...
football coach. I have been working in two different places. One was my own founded internet payment service, which is doing actually pretty good and the other place is at Karhu Kauhajoki, where I am the main coach for boys who are aged between 14 to 18. Also I went to body culture school in Denmark, which I graduated Cum Laude with GPA 4,9 out of 5,0. I have also finished Ahtme high school with gold medal, it is the only school in Estonia which bases mainly on football. I am a native estonian speaker and I can also speak and write perfectly in english, finnish and russian. In english and finnish I have reached upper conversation level and in russian advanced conversation level. I do not have any bad habits like smoking or drinking alcohol, because in my opinion it is very important to be a good example for my students. I do not have very long work experience because I
Violence is a major problem, it has affected people for ages. Although violence on television is not the greatest thing, it should be not be banned. In my opinion TV can be very educationaland it shouldn't be banned. Most people watch TV to get away from reality. Watching shows that depict a fantasy world are a lot more interesting to watch. People don't want to see things that happen to them on a regular bases. TV can be educating. For example, there are countries that you haven't visited. Some shows take you right in the middle of it and you don't even have to walk. People also watch TV to find out news. It's much faster than the paper and the picture is moving. In one point of view TV can be healthy. Sometimes seeing something that has happened to you before might be funny. Watching TV relieves stress and that is good for you. Doctors say that laughing is good for your health.
125,000. Baseball History Baseball has gone through many changes over the years. through19461960 baseball changed from basic hitting to a more powerful offense like home runs, and these were the years that they allowed African Americans to play. From 6179 baseball pitchers started to throw pitches like curveball and change ups to fake the batters out. Then from 80present is when records started to break like home run, stolen bases and most consecutive games played. Basketball History The game was invented in Springfield, Massachusetts. The man who created this game is Dr. James Naismith He invented the first thirteen rules of the game. It used to be with nine people on each side. The first ever game was to be played on Dec. 21, 1890. Basketball History The first NBA game was played on Nov. 1, 1946 Association of America which is now the NBA.The NBA now has 30
"lesbian lisp", although that would sound much better.) * Higher frequency in men and lower in women's case makes the listeners distinguish them as part of the LGB group. So does more technical or sophisticated way of speech. (From previous investigations where larger 15-90 s texts were used.) All in all, I am still awed and would really like to know, how and why this is possible. (You've heard me speak, which group would you put me into? And no cheating! :D) The acoustic and perceptual bases of judgments of women and men's sexual orientation from read speech Authors: Benjamin Munson _, Elizabeth C. McDonald, Nancy L. DeBoe, Aubrey R. White 2006 Goal: Three experiments examined acoustic and perceptual characteristics of the speech of Gay; Lesbian; Bisexual (GLB) and heterosexual people. Experiment 1 examined the acoustic characteristics of single words produced by both men and women who identified as either GLB or heterosexual. The largest differences between GLB and
houses to protect themselves from snow and rain and hunt animals for food all of these are actions which are working against nature. Creon is the character, who best symbolizes everything man-made, while Antigone is the one who is in connection with the Gods and nature. Creon, due to his excessive hubris, has forgotten about the centuries old traditions of Gods and thinks of himself as the leader on earth. At the same time Antigone actively believes in the Gods and bases justifications to her actions on the will of the Gods. Through the characters of Antigone and Creon, Sophocles is able to express his ideas about the balance between the artificial man- made world in comparison to the natural laws and traditions. The conflict between man and nature presented in Antigone has deepened my understanding of the customs and traditions of the ancient Greek era and influenced my perception of our current world
Organismi ainevahetus ja happe-leelise seisund Tartu Ülikool 2016 Happe-leelis seisund •• Arteriaalse vere (plasma) pH juures 7,37 – 7,43 • Keskmine : pH 7,4 • Happelised ainevahetusproduktid lähevad verre. • Happe- leelis tasakaalu hoiavad konstantsena vere puhversüsteemid, gaasivahetus kopsudes ja eritusmehhanismid neerudes. • Kõrvalekalle normaalsest pH-st pärsib vajalike ensüümide aktiivsust Neerude pH regulatsioon •• Väljutab mittelenduvaid happeid (nt väävelhapet). • Normaalse toitumise korral produtseerib inimene 24h jooksul 12-15 mooli CO2-e ja uriiniga väljutatakse 50 mmol hapet uriiniga. • Suure happe liia korral on terve neer võimeline eritama ka rohkem vesinik ioone. • Aluselise liia korral vesinikioonide sekretsioon väheneb. • väljutatakse põhiliselt seotuna ja külge Neerude pH regulatsioon • Normaalsetes tin...
Soviet military coup attempt in Moscow. The last Russian troops left on 31 August 1994. Estonia joined NATO on 29 March 2004 and the European Union on 1 May 2004. Retreat taganema Estonian Liberation War Eesti vabadussõda Tartu Peace Treaty Tartu rahuleping disband laiali saatma, minema political unrest poliitiline rahutus subsequently järgnevalt give one's assent nõustuma establish military bases asustama sõjaväe baasid mutual vastastikune perceive tajuma, märkama pillage rüüstamine, rüüstama unleash valla päästma fierce metsik, raevukas flee pagema nothing short of mitte vähem kui coup riigipööre
Glenn Miller and Artie Shaw. The music was fast and frantically paced and led to dances being banned from dance halls, as the young women being flung into the air by their partners showed their stocking tops and underwear. Jazz continued to be popular. 1940s - The Second World War brought fast, frantic (and often American) dance music - boogie-woogie or jitterbug. Dances were held in church halls, village halls, clubs, Air Force bases - everywhere! But slower, romantic songs were also popular as loved ones went away to fight, such as Vera Lynn's 'We'll Meet Again' and the song about coming home again, 'The 'White Cliffs of Dover'. After the war 'skiffle' bands became popular. These bands used household items, such as washboards and tea chests, as part of their set of instruments! Tommy Steele, who later became very famous, first played in a skiffle band. 1950s - Rock and Roll became very popular.
Many of them migrate to warmer places to escape the cold winter months, while others hibernate (sleep) through the winter when food is scarce. Some animals such as squirrels, chipmunks and jays store food when it is plentiful, using hollows of trees as storehouses for nuts and seeds. In winter this store of food keeps them fed. have adopted is food storage. Soil: Brown forest soils develop under the TBDF. Broadleaf trees tend to be nutrient-demanding and their leaves bind the major nutrient bases. Thus the litter under this forest is not as acidic as under needleleaf trees and aluminum and iron are not mobilized from the A horizon. The autumn leaf fall provides for an abundant and rich humus which begins to decay rapidly in spring just as the growing season begins. Kasutatud kirjandus: http://www.kidcyber.com.au/topics/biomeforest.htm http://www.marietta.edu/~biol/biomes/images/deciduous/deciduous_500.jpg http://www.runet.edu/~swoodwar/CLASSES/GEOG235/biomes/tbdf/tbdf.html
hewing the stone with their axes, and certainly the eastern wall shows signs of damage. This saga is the earliest recorded account of an assault on a Scottish castle. In 1263, Rothesay was taken again by the Norse under Haakon IV before the Battle of Largs. Although the Battle of Largs was indecisive, Haakon's campaign was unsuccessful, and effectively ended Norse influence in western Scotland.The 13th century curtain wall seen from the south-east, across the moat. The bases of the south-east and south-west towers can be seen.The early castle comprised only the roughly circular curtain wall, 3m thick and around 43m across, built on a low mound, with a battlement on top accessed by open stairs. The moat was connected to the sea, the shoreline being some 100m further south than today. The broad crenellations can be made out within the walls, which were later raised. Holes in the upper wall would
The northern and the north-eastern parts of the South Island are the sunniest areas in New Zealand - the people out there have about 100 sunny days a year. Economy. Largest Cities Economy in New Zealand is very modern and developed. It's GDP is about 101,688 billion dollars (data from 2005). Country's GDP is ~$26,400 per one resident (for example in Australia it's $31,900 and in USA $41,800). New Zealand is a country which mostly bases on its bargaining, agricultural production. 20% of agricultural produce is exported. Most important export partners are Australia, USA, Japan, China, Germany. The country's biggest incomes comes from tourism. Every year about 2 million tourists visit New Zealand - it's marketed as a green and clean adventurous place. Typical tourist attractions there are bungee jumping and whale watching. The capital city of New Zealand is Wellington, but it isn't the largest one. The
uurijaid rohkem selles, et platseebo rakendamine kontrollkatsetes ei pea alati olema ebaeetiline või negatiivse moraalse alatooniga. Kõigile keerulistele meditsiinilistele ja eetilistele probleemidele vaatamata võib platseebo olla üks kõige efektiivsemaid ja tähtsamaid elemente iga ravija jaoks. Kasutatud allikad Freedman, B. (1987). Equipoise and the ethics of clinical research. N Engl J Med, 317. 141- 145. Fuente-Fernandez, R. & Stoessl, A.J. (2004). The Biochemical Bases of the Placebo Effect. Science and Engineerig Ethics, 10, 143-150. Gaudiano, B.A. & Herbert, J.D. (2005). Moving From Empirically Supported Treatment Lists to Practice Guidelines in Psychotherapy: The Role of the Placebo Concept. Journal of Clinical Psychology, 61(7), 893-908. Kemp, A.S., Kalali, A.H., Schooler, N.R., Alphs, L., Anand, R., Awad, G. ... Vermeulen, A. (2008) What Is Causing the Reduced Drug-Placebo Difference in Recent Schizophrenia Clinical Trials and What Can be Done About It
first put on a piece of silk or other thin fabric. · Different core/chassis solutions: · Finishing: the bases must be put through a machine that grinds and polishes them, and this is done with a combination of belt sanding and stone grinding. Ofcourse,
physical work, whereas Puritans valued education and thus were higher in the social and economic status. Pilgrims wanted to separate from the Church of England, while Puritans simply wanted to “purify” it. 11. What was The Mayflower Compact and why was it an important document? Name two important principles that this document included. The Mayflower Compact was the first governing document of Plymouth Colony, signed onboard the Mayflower. The two principles later became the bases of the Constitution of the United States. 1) The people would vote about the government and laws, 2) the people would accept whatever the majority chose. 12. What important principle regarding religion was established in Rhode Island and some of the other colonies? Separation of church and state. 13. Name examples of democratic institutions in the colonies. House of Burgesses vs. House of Representatives 14. What is representative democracy? Give an example.
interesting stuff), then I recommend checking out Testing Curator http://blog.testingcurator.com/ Typical categories: articles and blogs, (test) tools and programming, conferences and other events, podcasts. Books Lessons Learned in Software Testing by Pettichord, Kaner, Bach. A book that gives you a crash course and useful tips in almost everything to do with software testing. You can dip in and out of this book when needed. Testing Computer Software by Nguyen, Kaner, Falk. Covers all the bases. Perfect Software and Other Illusions about Testing by Weinberg. This will help you understand quite a bit about the context and human difficulty around software development and testing. Explore It! By Elisabeth Hendrickson is an awesome book on exploratory testing that contains a lot of practical tips. Testing Magazines The testing magazines publish articles from practitioners. Sometimes reading an article on a topic may be just enough to help you understand a concept
long, these British officials spent most of their working lives there and so developed a distinctly Anglo-Indian way of life ❆ They imposed British institutions and methods of government on the country, and returned to Britain when they retired. ❀ Large parts of Africa also belonged to the empire. ❆ Except for South Africa, where there was some British settlement, most of Britain's African colonies started as trading bases on the coast, and were only incorporated into the empire at the end of the century. ❀ The empire included numerous smaller areas and islands aswell. ❀ There was an enormous increase in wealth during the century, so that Britain became the world's foremost economic power. ❀ The British came to see themselves as having a duty to spread this culture and civilization around the world. 1868 The TUC (Trades Union Congress) is formed. 1870
collectively called ligands, or more specifically, protein ligands -- form a chemical bond. 3. TATA-box is a DNA sequence (Cis-regulatory element) found in the promoter region of most genes in eukaryotes. It is the binding site of either transcription factors or histones and is involved in the process of transcription by RNA polymerase. It has the core DNA sequence 5'- TATAAA-3' or a variant, which is usually followed by three or more adenine bases and has been highly conserved through evolution. The TATA box is usually located 25 base pairs upstream to the transcription site. 4. Nimeta peamised DNAd siduvad domäänid, mis on iseloomulikud transkript-sioonifaktoritele (vähemalt 3) a. Homedomään valgud, tsink-sõrm valgud (zinc-finger), leutsiin lukud, heeliks-ling-heeliks (helix-loop-helix). 5. Mis roll on histoondeatsetülaasidel (HDAC) ja mis funktsioon on histoon-atsetülaasidel (HAT)? a
From 1759 to 1931 Canada was a part of the British Empire,but in 1931 they got an independence from Britain. Canada's prime minister is Steven Harper. First constitution of Canada was adopted in 1982. Until that the act of Great Britain's parlament was inforced. Head of state is locally presented by generalgovernor. The legislative institution is parlament that has two houses. The members of Senat are appointed by generalgoverner on the bases of the propose of Prime Minister. The House of Representatives are elected on general direct elections for five years.The state is governed by the Government that reports to the Parlament. The Prime Minister is the leader of the party that holds a majority in the Parlament. Every Province has it's own Parlament and Government. The monarchy is represented by the leutenantgovernor. The Frenchspeaking province of Canada (Quebec) is very different culturally
DENOTATIVE AND CONNOTATIVE MEANINGS IN MOTION GRAPHICS TEXT For Multimedia Semiotics To begin with, what is motion graphics? Motion Graphics is a piece of video which is created digitally in a computer and as the name refers bases on moving graphical elements. These elements can be images, text, graphical designs or a multidimensional imagery. But this term should not be confused with another term ,,animation". Line between these two is a bit blurred. Animation often is only giving life to the characters and scenery. Also, it can be done in real world with physically created sets. Motion graphics on the other hand can be only created in digital world and could include animation. But also there are more two very
(ii) transcription / transcribed; R transcriptase 1 (b) (i) J anticodon; R anticodons K transfer RNA / tRNA; L ribosome / rRNA; M codon; R codons 4 (ii) 1 DNA triplet / codon / M / mRNA triplet, codes for specific amino acid; 2 order of, triplets / bases, determines the order of amino acids; 3 tRNA / K, has, corresponding / complementary, triplet / anticodon; 4 (tRNA / K) attached to specific amino acid; 5 activation of amino acid; 6 2 (tRNA) binding sites on the ribosome; 7 codon and anticodon bind; A match 8 A to U and C to G; 9 adjacent amino acids join;
Autor: Eliys Tomson Arstiteadus II, 7. Rühm Sõnade arv 1493 Tartu 2010 Summary Metabolism is one of the things that can be used to classify bacteria. For example aerobic and anaerobic bacteria are differentiated on the bases of their need for oxygen in the metabolism. The following report is a brief overview of bacterial metabolism, that is mostly concentrated on the diffrence between anaerobic metabolism ja aerobic metabolism. Because of the complexity of bacterial metabolism the report is mainly about the fundamental diffrences in catabolism (enzymes used and energy and products that are gained) and the defenceses that are used against oxidative stress
4. Connect the climate diagram and biome. Temperate grassland- vähe vihma, temp 20 ; Taiga- 20-15°C, kesk vihm. Rainforest: VÄGA PALJU VIHMA, temp 4-12 °C. ; Temperate deciduous forest: temp 20, kesk. vihm 5. Describe the soils of the. Temperate deciduous forest: Brown forest soils develop under the trees. Broadleaf trees tend to be nutrient-demanding and their leaves bind the major nutrient bases. The autumn leaf fall provides for an abundant and rich humus which begins to decay rapidly in spring just as the growing season begins. The humus content gives soil horizons a brown colour. Temperate rainforest: This forest has nutrient-rich soil because there is a lot of dead organic matter on the ground. This dead material is being slowly digested by the fungi, insects, and bacteria that live here. Temperate Grasslands: Calcification is the dominant soil-forming process in semiarid regions
gcggaaaataacggcggctataaagcaattaattacggttacaccgacgatcgtgtttac agcaaattgaccagcgaaaacccgattgatctggtgcgttatcagttagctaactgctat atgggtcgggctgggttgataaactccggcggtgctgcgggcggtgaaactgacctcagc gatgcagtgcgtactgcggttatcaacaaacgcgcaggcggaatggggctgattcttgga cgtaaagcgttcaagaaatcgatggctgacggcgtgaaactgattaacgccgtgcaggac gtttatctcgatagcaaaattactatcgcctga 10 manipulatsiooni aldolaasi E. coli nukleotiidse järjestusega: 1) Filter DNA >filtered DNA sequence consisting of 1075 bases. canActataacaCctataacaNatgacagatattgcgcagttgcttggcaaagacgccga caaccttttacagcaccgttgtatgacaattccttctgaccagctttatctccccggaca tgactacgtagaccgcgtaatgattgacaataatcgcccgccagcggtgttacgtaatat gcagacgttgtacaacaccgggcgtctggctggcacaggatatctttctattctgccggt tgaccagggcgttgagcactctgccggagcttcatttgctgctaacccgctctactttga cccgaaaaacattgttgaactggcgatcgaagcgggctgtaactgtgtggcgtcaactta cggcgtgctggcgtcggtatcgcggcgttatgcgcatcgcattccattcctcgtcaaact taatcacaacgagacgctaagttacccgaatacctacgatcaaacgctgtatgccagcgt
I have outlined why diverse, well-balanced and moderate diet is so important. The main nutrients like carbohydrates, proteins and fats, were closely observed. A couple of questions were raised in the survey. Whether the seven-formers of Saue Gymnasium have diverse diet or not? Which nutrients are over-consumed and where is deficiency? What are the differences between the boys' and girls' eating habits. My answers were based on the analyses of 42 students' daily menus. On the bases of the survey we can say that the seven-formers of Saue Gymnasium have diverse diet. However, the consumption of carbohydrates is lower than norm. Consumption of proteins and fats is within norm. It turned out that boys consume more carbohydrates as well as proteins, than girls do. In conclusion, the author finds the topic most useful and educative. However, we cannot draw further conclusions because of short time, just one day. For more reliable results a longer period, a week, should be taken
Chapter 8 - Flexible budgets, overhead cost variances, management control Standard costing is a costing system that traces direct costs to output produced by multiplying the standard prices or rates by the standard quantities of inputs allowed for actual outputs produced and allocates overhead costs on the basis of the standard overhead-cost rates times the standard quantities of the allocation bases allowed for the actual outputs produced. Budgeted variable overhead cost rate per output unit = budgeted input allowed per output unit x budgeted variable overhead cost rate per input unit. Variable overhead flexible-budget variance measures the difference between actual variable overhead costs incurred and flexible-budget variable overhead amounts. Variable overhead efficiency variance is computed the same way as the efficiency variance for direct-cost items, but the interpretation differs
Undisciplined--controlled Relaxed--tense Eysenck's (1916-1997) Trait Theory Eysenck's Personality Theory Dimension Constituent Traits (correlated) · Biological bases of traits E: and cerebral cortex arousal levels Neuroticism Anxious, depressed, guilty, N: and autonomic nervous system reactivity low self-esteem, moody, etc. · Clinical & social relevance
European explorers and trappers brought European diseases that spread rapidly through native trade routes and decimated the Aboriginal population. For much of the 17th century, the English and French colonies in North America were able to develop in relative isolation from each other. French colonists extensively settled the St. Lawrence River valley, while English colonists largely settled in the Thirteen Colonies to the south. However, as competition for territory, naval bases, furs and fish escalated, several wars broke out between the French, English and Native tribes. 13. Political system, symbols Canada is a constitutional monarchy with Elizabeth II, Queen of Canada as head of state, and a parliamentary democracy with a federal system of parliamentary government and strong democratic traditions. Formally considered a constitutional monarchy, Canada is governed by its own House of Commons. While the governor-
Thames, the Battle of Caer Caradoc and the Battle of Mona. Following a general uprising in which the Britons sacked Colchester, St Albans and London, the Romans suppressed the rebellion in the Battle of Watling Street and went on to push as far north as central Scotland in the Battle of Mons Graupius. Tribes in modernday Scotland and Northern England repeatedly rebelled against Roman rule and two military bases were established in Britannia to protect against rebellion and incursions from the north, from which Roman troops built and manned Hadrian's Scotland had been inhabited for thousands of years before the Romans arrived. However, it is only towards the Roman period that Scotland is recorded in writing. In the 4th century BC Aristotle knew of "Albinn" and "Ierne" (the islands of Great Britain and Ireland). The
The coalition nations, together with the United Nations, began to work for establishing a stable, democratic state, capable of defending itself. End of the war On April 30, 2009, the United Kingdom formally ended combat operations. Prime Minister Gordon Brown characterized the operation in Iraq as a "success story" because of U.K. troops' efforts. The withdrawal of U.S. forces began at the end of June, with 38 bases were handed over to Iraqi forces. On June 29, 2009, U.S. forces were recalled from Baghdad. The last U.S. combat brigades departed Iraq in the early morning of August 19, 2010. Casualties Casualties of the conflict in Iraq since 2003 have come in many forms, and the accuracy of the information available of Iraq War casualties varies greatly. For troops in the U.S.-led multinational coalition, the death toll was carefully tracked and updated daily, and the names and
of authority. Each state has its government and all of them have the dual character of both Federal and State government. The political system of the USA is divided into three branches: judicial, legislative and executive. Each branch holds a certain degree of power over the others, and all take part in the governmental process. The constitution of the USA. Although the American system of government is based on Great Britain's, it differs in having a written constitution, that is the bases of all government and law. The constitution of the US was adopted after the War of Independence on the 17th of September 1787. It lists the set of rules, law regulations, which provide the practical norms, regulating the work of the government. The document imbodied the practical theories of man of property. The main principle underline the constitution was as follows: "Private property is the backbone of liberty". It was put forward by a rich plantation
The task of L is to establish the general features of modern Engl voc. Theoretical L. gives a complete picture of voc. Practical value lies in using and appretiating the lg more conciously. There is diachronic (historical) L that studies origin and development; syncronic studies voc at a given historical period. There are general L (studies words disregarding particular features of any particular lg); special L (studies specific features of a separate lg, there is Engl that bases on general L); contrastive (compares vocabularys in different languages). 2. Connection of L with other linguistic disciplines a) the word performes a certain grammatical function (nt, he always misses the class, how many misses are there; the girl powders her nose, soliders face powder)In speech words are combined according to grammatical rules. The plural of nouns may carry a new meaning (nt, arms-weapons, looks-appearance, works-plant) b)connected with phonetics
involvement. Other conventional prognostic variables include the site of the primary tumor and tumor histology . Cellular ClassificationOne clinicopathologic staging system involves evaluation of tumor specimens for the amount of stromal development, the degree of neuroblastic maturation, and the mitosis-karyorrhexis index of the neuroblastic cells. Favorable and unfavorable prognoses are defined on the bases of these histologic parameters and on patient age. The prognostic significance of this classification system, and of related systems using similar criteria, has been confirmed in several studies. Neuroblastomas containing many differentiating cells, termed ganglioneuroblastomas, tend to have favorable biological properties and have a better prognosis Ravi: madalariskiga juhtudel peamiselt operatsioon (+kemoteraapia). Keskmise riskiga:
There is a fireworks show and events held on an ice stage. Aomori Nebuta Festival This festival is held annually and features colorful lantern floats called nebuta which are pulled through the streets of Central Aomori. This festival is held from about August 2-7 every year. This event attracts millions of visitors. During this festival, 20 large nebuta floats are paraded through the streets near Aormori JR rail station. These floats are constructed of wooden bases and metal frames. Japanese papers; washi, are painted onto the frames. These amazing floats are finished off with the historical figures or kabuki being painted on the paper. These floats can take up to a year to complete. There is a dance portion of this festival. There are haneto dancers and they wear special costumes for this dance. Everyone is welcome to purchase their own haneto costume that they may too join in on the fun (Mishima, Aomori Nebuta Festival). Nango Summer Jazz Festival
bank ( 800 000 in example of the bank described by Figure 2 that has acquired 40 000 000 of deposits). The remaining part of non-invested reserves comprises excess reserves. Balance sheet 2b. Deposits inflow. Assets ( ths.) Liabilities ( ths.) Required reserves 800 Deposits 40000 Excess reserves (cash 44200 Bank Capital 5000 or ...) The banks tend to hold ... The excess reserves form the bases of the bank's operations. For example, our bank above is able to extend loans to its clients in maximum amount of 44 200 000 as described in Figure 3. Balance sheet 3. Bank making loans. Assets ( ths.) Liabilities ( ths.) Required reserves 800 Deposits 40000 5 For simplicity we assume in examples of this chapter that there are no other regulations exept the initial capital requirement and reserve requirement based
proposed method. FIGURE 16. some details about the pilling parameters of standards obtained from the system devised in [31] and the EMPA standards. A more recent approach to pilling evaluation based on the wavelet reconstruction scheme was investigated in [32]. The method, preliminary evaluated using SM50 European standard pilling images, shows that reconstructed resolution level, wavelet bases and sub-image used for reconstruction affect the segmentation of pills and, thus, pilling grading. The area ratio of pills to total image was successfully used as a pilling rating factor (in analogy with a good number of works belonging to the all the 3 categories mentioned before). In [33] frequency-domain image processing is used to separate periodic structures in the image (the fabric weave/knit pattern) from non-periodic structures in the image (the pills).
Anneli Josu Mai-Liis Õnnis Tallinn 2017 Summary The author chose to write her practical research of "The making of a nature inspired dress and main changes in fashion in the years 1910-1990". The choice of this theme resulted from the hobbies and passion thowards fashion. The author herself is a model and is thus connected to fashion on a daily bases. One of her dreams is to design and create clothes for people who care for fashion as a form of art, not just a piece of fabric. Her idea of fashion is similar to a famous designer Ellie Saab who once said: "Anything can be a source of inspiration. Imagination is important to be able to create but one must also be inspired by everything around them, whether it is nature, art, etc. Any idea or any thing seen could be a source of inspiration to the creator." (Saab 2010).
The excessively harsh policies of the duke and of the Inquisition resulted in open revolt in the Low Countries. William I, the Silent, prince of Orange, who was one of the principal noblemen of the region, led the revolt. Initially unsuccessful, the Dutch then concentrated their efforts in the north. After William's naval supporters, called the Sea Beggars, seized the Holland port of Brill (Brielle) in 1572, the rebels took control of most northern towns, which became the bases of the revolt. William tried to maintain the unity of north and south but was unable to hold the north against the brilliant campaigns of reconquest led by a new Spanish commander, Alessandro Farnese. (3) In 1579 the Union of Utrecht, an anti-Spanish alliance of all northern and some southern territories, was formed. The union signified the final divergence of the northern part of the Low Countries, which later became the Netherlands, from the southern part, which later became Belgium
mis annavad sellele tegevusele tähenduse. Erinevad mõiste ,,kultuur" definitsioonid peegeldavad erinevaid teoreetilise mõistmise viise või inimtegevuse hindamise erinevaid kriteeriume. Teatud konteksides tähistab mõiste kultuur artefakte [teoseid] muusikas, kirjanduses, maalikunstis, teatris ja filmis. Culture generally refers to patterns of human activity and the symbolic structures that give such activity significance. Different definitions of "culture" reflect different theoretical bases for understanding, or criteria for evaluating, human activity. In some contexts, a frequent usage of the term culture is to indicate artifacts in music, literature, painting and sculpture, theater and film. 1 1. loeng Sissejuhatus: kultuuri mõistest ja määratlustest Encyclopaedia Britannica (2003): "Inimesele e
Philip Larkin’s Poetry: Themes, Form, Style, Imagery and Symbolism Author: Sandra Olivares González Tutor: Jesús Marín Calvarro Degree in English Studies, English Department, Faculty of Philosophy and Letters, University of Extremadura Cáceres, 29th January 2016 Philip Larkin’s Poetry: Themes, Form, Style, Imagery and Symbolism The aim of this work is to obtain some characteristics of the poetry of Philip Larkin, such us the origin of his themes, the way in which he writes his poems and the symbolism he uses (which is a very controversial topic because some assume that he does use it, while some others say that he uses it in an ironic way). In this work we tried to make a revision on the vision of Larkin through the studies that had been made on him, and on the basis of it we can say, that the voice of ...
framing questionnaire preserve the actual meanings that actors ascribe to these Teksti- Sisuanalüüs (võtmesõnade Understanding participants actions and settings. Qualitative research can thus provide analüüs loetlemine, analoogne esimeste categories bases for understanding social processes that underlie interneti otsingumootoritega). management." Content analysis, i.e. counting in 2. ,,Qualitative research can also provide memorable examples terms of researchers category of important management issues and concepts that enrich
maailmas. Arvan, et kuna mõlematel riikidel on nii palju sarnasusi ja on olemas pikk kooselu kogemus, võiks notariaalameti esindajad selles valdkonnas rohkem koostööd teha kuna koostöö oli ja on alati parim arenguviis. 43 CONCLUSION From historical point of view it is obvious, that Estonia and Russia had common bases for the development of notary institution. Estonian notarys and King-Russia notarys had a lot of similarities. Notariates of both countries conformed to the standards of Latin notariate, but they were liquidated because of NSV Union power establishment. That is why in all NSV Union territory, including Estonia, state notariate laws were used. In bachelor`s work according to the chosen topic are considered Estonian and Russian notarial systems
principality, his son Pedro, with the overwhelming support of the Brazilian elites, declared Brazil's independence from Portugal. Cisplatina (today's sovereign state of Uruguay), in the south, was one of the last additions to the territory of Brazil under Portuguese rule. COLONIAL RESTORATION At the height of European colonialism in the 19th century, Portugal had already lost its territory in South America and all but a few bases in Asia. Luanda, Benguela, Bissau, Lourenço Marques, Porto Amboim and the Island of Mozambique were among the oldest Portuguese-founded port cities in its African territories. During this phase, Portuguese colonialism focused on expanding its outposts in Africa into nation-sized territories to compete with other European powers there. With the Conference of Berlin of 1884, Portuguese Africa territories had their borders
display of the RNC in day or night colours as appropriate. As a digital copy of the original paper chart, a RNC has no intelligence and other than visually, cannot be interrogated for e.g. automatic route checking or hazard warnings; however some of these limitations can be minimised by manual user input to the ECDIS. RNC data format and production RNCs are normally produced by digitally scanning the stable colour bases used in the multi-colour printing process. Unlike ENCs there is not a single accepted format for RNCs. The main formats are • BSB (used by USA, Canada, Cuba and Argentina), and • HCRF (used by UK, Australia and New Zealand). RNC Visualisation • RNCs are designed to be displayed at the same resolution as that which they are provided. Excessive zooming in or out of the same image seriously degrades the RNC image
latitude 60 (includes all ice shelves, doesn't prohibit using rights under IL concerning high seas). So Antarctic was an international territory. So it is a common heritage of mankind. It was prohibited to make any new claims on it or enlarge existing claims on it (these were proclaimed as frozen ones). Antarctic is a peaceful zone, any military activities are prohibited, inter alia, any measures of military nature, establishment of military bases, tests of equipment and weapons, fortification. It was permitted to use military equipment for scientific research/purposes. Prohibited to do nuclear explosion and to dispose any nuclear waste. Member states can compose expeditions (under the organizing state's jurisdiction) and polar stations (under the state's jurisdiction) and they are under the jurisdiction of the state, but not the territory.
while there was a argument regarding adding extra charges on a "national treasures" to keep them in the country. But Article 36 can only be used to justify a non-fiscal barriers falling within Article 34 TEFU (case 26/62 Van Gend en Loos [1963]). Article 30 does not apply to charger for services. So taxes caught by an Article 30 might be defined on a bases of Article 36 TFEU if those are not fiscal and not involve charges to services. Exceptions are if a charge is not a customs duty or charge having equivalent effect if: it relates to a general system of internal dues applied systematically and in accordance with the same criteria to domestic products and imported products alike, if it constitutes payment for a service in fact rendered to the economic operator of a sum in
*The British expansion in East Africa The Sultan of Zanzibar received, in exhange of some of his terriories in the north, a land along the coast which the british East Africa Company leased. Zanzibar was annexed and recognized as a British protectorate. A protectorate was also established over the Republic of Uganda. A year later British East Africa became a protectorate. *The British expansion in West Africa The unprofitable coastal stations in Sierra Leone had provided useful bases for the campaign against the slave trade. When the Dutch government sold their Gold Coast forts to UK, Britain controlled the entire coast. The island of Lagos proved a useful commercial port and the gateway to the rich palm-oil regions. The Berlin Conference opened the continent to European invaders. The territories of the Royal Niger Company were taken over by the crown and recognized as the protectorates of Northern and Southern Nigeria.
most of them fail. Very few. In 1949 Faulkner receiver Nobel Prize. In his speech he expressed hope, that people will not only indure but they will prevail. The second world war. Post WWII literature. After 1945. America emerged as a superpower, it was untouched from the war. America helped Europe to rebuild itself. The famous Marshall's plan. America was ready to give money to Europe to stop the communists. a lot of military bases were organized in Europe. Gradually the cold war developed between the former allies-USA and USSR. The result of the cold war, there began intellectual terror, in USA and USSR. The intellectual terror is embodied in the character Senator McCarthy, very odeous figure, suspected that many American intellectuals were secret communists. he organized modern whichhunts. He ruined the lives and careers of very talented Americans. Existentsialism became dominent philosophies-choices, no happiness, if
Eldon Regeneration Recycled Desk Accessories, Smoke Catalog Binders with Expanding Posts Xerox 1966 Avery 474 6" Cubicle Wall Clock, Black 3395 Wilson Jones Hanging View Binder, White, 1" Tenex Carpeted, Granite-Look or Clear Contemporary Contour Shape Chair Mats Bretford Rectangular Conference Table Tops Super Decoflex Portable Personal File Okidata ML390 Turbo Dot Matrix Printers Chromcraft Bull-Nose Wood Oval Conference Tables & Bases Tripp Lite Isotel 6 Outlet Surge Protector with Fax/Modem Protection Imation 3.5" Diskettes, IBM Format, DS/HD, 10/Box, Neon Binder Clips by OIC Acme® Box Cutter Scissors Smead Adjustable Mobile File Trolley with Lockable Top Kleencut® Forged Office Shears by Acme United Corporation Belkin 6 Outlet Metallic Surge Strip Avery 487 Wirebound Voice Message Log Book DAX Solid Wood Frames Xerox 1992 Tripp Lite Isotel 6 Outlet Surge Protector with Fax/Modem Protection
annaabi.ee 
Sisene Facebook'ga
Sisene Google'ga
Sisene LinkedIn'ga
