Vajad kellegagi rääkida?
Küsi julgelt abi LasteAbi
Logi sisse
Sulge

"ladder" - 59 õppematerjali

Elektriajamite juhtimine labor 2
4
doc

Elektriajamite juhtimine labor_2

~ 230 V O0,01 O0,02 TSX 1720 I0,01 I0,02 I0,03 I0,04 +24V F4 S1 S2.1 S3.1 S2.2 S3.2 1. Töö eesmärk Õppida koostama kontaktjuhtimisskeemi alusel vajalikku juhtimisprogrammi, kasutades programmeerimiskeelelt PL7-1 Ladder Diagram, ning seda realiseerima programmeeritava loogikakontrolleri TSX 1720 abil. 2. Töö käik 1. Koostada joonisel 2 kujutatud kontaktjuhtimisskeemi alusel programm käsuloendi kujul, kasutades programmeerimiskeelelt PL7-1 Ladder Diagram. Joonis 2 kontaktjuhtimisskeem 2. Sisestada koostatud programm loogikakontrollerisse. 3. Kontrollida sammhaaval sisestatud programmi ning vajadusel parandada vead. 4

Elektroonika → Elektriajamite juhtimine
23 allalaadimist
Elektriajamite juhtimine labor 3
3
doc

Elektriajamite juhtimine labor_3

KM1 KM2 ~ 230 V O0,01 O0,02 TSX 1720 I0,01 I0,02 I0,03 I0,04 I0,05 F4 S1 S2 S3.1 S4.1 +24V 1. Töö eesmärk Õppida koostama kontaktjuhtimisskeemi alusel vajalikku programmi, kasutades programmeerimiskeelelt PL7-1 Ladder Diagram, ning seda realiseerima programmeeritava loogikakontrolleri TSX 1720 abil. 2. Töö käik 1. Koostada joonisel 1 kujutatud kontaktjuhtimisskeemi alusel programm käsuloendi kujul, kasutades programmeerimiskeelelt PL7-1 Ladder Diagram. F4 Joonis 1 kontaktjuhtimisskeem L1 L2 L3 N Q 2.

Elektroonika → Elektriajamite juhtimine
22 allalaadimist
Elektriajamite juhtimine labor 4
4
doc

Elektriajamite juhtimine labor_4

2 2 2 2 Joonis 2 kontaktjuhtimisskeem O0,04 I0,01 O0,01 O0,01 O0,02 O0,02 O0,03 O0,03 O0,04 1. Töö eesmärk Õppida kasutama taimereid programmeerimiskeeles PL7-1 Ladder Diagram koostatud juhtimisprogrammides. 2. Tööülesande kirjeldus Valgustusinstallatsiooni valgustid peavad süttima ühe joonisel 1 toodud tsüklogrammi järgi. Valgustusinstallatsiooni juhtimiseks tuleb ette näha kaks võimalust: - sisse- ja väljalülitamine fikseeritud asenditega lüliti, näiteks tumbleri abil; - sisse- ja väljalülitamine isetagastuvate käsklusaparaatide, näiteks juhtimisnuppude abil.

Elektroonika → Elektriajamite juhtimine
19 allalaadimist
Unit 2 test-8 klass
4
docx

Unit 2 test (8 klass)

2) 1. To 2. Up For 3. Of For Up 4. With 5. For On By 6. With 7. At 8. To To 3) 1. Was testing, sank, had to 2. Had read, went 3. Was riding, took 4. Was having, heard, had finished, called 5. Were bilding, started 6. Had sat, started 7. Was reading, entered 8. Didn’t have to, decided 4) 1. 4 playing pieces, 2 dice and a game board 2. The player with the highest number will start 3. At the square nr1 4. Once 5. Is taken by another player 6. I moved up the ladder and places the playing piece on the square at the top of the ladder. 7. I moved down the snake and places the playing piece on the square with the snake’s tail-end.

Keeled → Inglise keel
3 allalaadimist
8-klassi Inglise keel - Unit 2
3
doc

8. klassi Inglise keel - Unit 2

the questions 1) What do you need to play the game? - To play the game you need 4 playing pieces, 2 dice, and a game board. 2) Who will start the game? - The player with the highest number 3) Where do you start the game? - At square one 4) When It's your turn how many time can you throw the dice? - You can throw the dice only one time. 5) Which square can't you move to? - To square which is taken by another player. 6) What can you do when you land on a square at the bottom of a ladder? - You can move up the ladder. 7) What do you have to do when you land on the head of a snake? - You have to move down the snake. 5 Write about the games you used to play as a small child. (50- 80 words)

Keeled → Inglise keel
134 allalaadimist
Digitaal-analoog muundur
1
doc

Digitaal-analoog muundur

Digitaal-analoog muundur Väga tihti on vaja digitaalsignaal muuta analoogsignaaliks. See tähendab, et mingisugune kahendarv on vaja muuuta kindla nivooga pingeks. Näiteks: Meil on 4-bitine arv ­ 1010BIN>10DEC Süsteemis on maksimaalne pinge 5 V. Nelja bitiga saame eristada 16 olekut (0-15): 0DEC> 0 V ja 15DEC> 5 V Uanalog=5/15 * 10= 3,33 V Sellise protsessi teostamiseks sobib väga hästi järgmine skeem, seda kutsutakse R-2R Ladder. Skeemil on näidatud kuhu tuleb ühendada bitid. R ja 2R tähendab seda, et takisti 2R on 2 korda suurem kui R nt: 10 k ja 20 k. Loomulikult peab arvestama seda et takistused ei oleks liiga väikesed, sest siis muutub vool ahelas liiga suureks. Väljundpinge saab väljaviigust Out. Selleks, et skeem korralikut töötaks tuleb anda sisenditele ,,0" ja ,,1" korrektselt ­ kui on ,,0" siis peab sisend ühenduses olema maaga (Gnd).

Elektroonika → Elektroonika
32 allalaadimist
You are what you think you are
1
odt

You are what you think you are

I do not agree with people who say that karma decides your life, or that everything is decided before you were born. I know, that if you work hard and put a lot of effort in your life, you will be succesful. Of course there are a lot of people, who would disagree with me, and a lot of them have great and logical explanations and theories, but in my opinion it just is not true. For example, every politican or person on a high paying job, who i have ever seen, has worked his way up the career ladder. Usualy they have studied very hard in school, to get to where they want to be. Most of them have gotten to where they want to be. Of course there are people who have gotten to important positions in life thanks to luck and many of them have had a lot of good ideas or have the imprtant knowledge, but majority of people are not that talentes so they have to work hard in life. I belive that if you set lifegoals to yourselt and imagine yourself completing those goals, you have

Keeled → Inglise keel
3 allalaadimist
Eessõnad
1
doc

Eessõnad

*in Tamme street (Tammel *near the postoffice from the table (laualt) tänaval) (postkontori ligidal) from work (töölt) 3. Ümbritsevad kohad *under the table (laua all) from the library *in the garden (aias) *above the table (laua kohal) (raamatukogust) *in the picture (pildil) *behind the house (maja taga) off the ladder (redelilt maha) *in a car (autos) *between the houses (majade off the horse (hobuse seljast *in the sky (taevas) vahel) maha) *in the corner (nurgas) *in front of the house (maja 4. Grupid, organisatsioonid ees) VIISIMÄÄRUSES ESINEVAD *in the army (sõjaväes) EESSÕNAD

Keeled → Inglise keel
61 allalaadimist
Ohutusvarustus
9
ppt

Ohutusvarustus

not using the dictionary Safety equipment ­ohutusvarustus Put up ­üles seadma Safety boots ­kaitsesaapad Collapse ­kokku kukkuma Hard hat ­kiiver Mineral wool ­mineraalne vill Gloves ­kindad Dusty ­tolmune Goggles ­kaitseprillid Solvent ­lahusti Dust mask ­tolmumask Protect ­kaitsma Ear protectors ­kõrvaklapid Overalls ­tunked Ladder ­redel Bucket ­ämber Scaffolds/scaffoldings ­tellingud Yard ­aed Garbage ­ prügi Toolkit ­ tööriistkomplekt Insurance -kindlustus Waste ­jääk Catch fire ­põlema minema Safety equipment · Now add your own ideas about safety equipment for cabinetmakers. Add at least 5 ideas.

Ametid → Tisleri eriala
34 allalaadimist
Letter and Essay 2008
1
docx

Letter and Essay 2008

Nevertheless, going to work after secondary school has its advantages too, particularly when a person is not interested in studying hard for five years. For example, it is wise to start working in a large company, where you have room for growth and which has a higher number of positions. Therefore, you can get your foot in the door and have the opportunity to build your skills, earn money and start climbing the career ladder. In conclusion, although I would rather go to university after secondary school to give myself more options in the future, joining the workforce right after school may not be a bad idea either. It is important to bear in mind that everyone are different and should make a decision according to their personality, wants and wishes.

Keeled → Inglise keel
427 allalaadimist
Inglise keele eessõnad
1
docx

Inglise keele eessõnad

(Ta jäi sinna kolmeks päevaks.) FROM: I took it from the box. (Võtsin selle kastist.) IN: In summer they stayed in town. (Suvel jäid nad linna.) IN FRONT OF: He stopped in front of the house. (Ta peatus maja ees.) INSIDE: They are inside the house. (Nad on majas.) INTO: Let him into the house. (Lase ta majja.) NEAR: Our house is near the postoffice. (Meie maja on postkontori ligidal.) OF: He bought a bar of chocolate. (Ta ostis tahvli sokolaadi.) OFF: Dick fell off the ladder. (Dick kukkus redeli pealt maha.) ON: Put it on the table. (Pane see lauale.) OUT OF: She took her purse out of her pocket. (Ta võttis taskust rahakoti.) OVER: He climbed over the fence. (Ta ronis üle aia.) PAST: He went past the house. (Ta läks majast mööda.) ROUND: The earth turns round the sun. (Maa tiirleb ümber päikese.) SINCE: I haven't seen her since Monday. (Ma pole teda esmaspäevast saadik näinud.) THROUGH: The river flows through the town. (Jõgi voolab läbi linna.)

Keeled → Inglise keel
77 allalaadimist
Inglise keele eessõnad näidetega
2
docx

Inglise keele eessõnad näidetega

(Ta jäi sinna kolmeks päevaks.) FROM: I took it from the box. (Võtsin selle kastist.) IN: In summer they stayed in town. (Suvel jäid nad linna.) IN FRONT OF: He stopped in front of the house. (Ta peatus maja ees.) INSIDE: They are inside the house. (Nad on majas.) INTO: Let him into the house. (Lase ta majja.) NEAR: Our house is near the postoffice. (Meie maja on postkontori ligidal.) OF: He bought a bar of chocolate. (Ta ostis tahvli ðokolaadi.) OFF: Dick fell off the ladder. (Dick kukkus redeli pealt maha.) ON: Put it on the table. (Pane see lauale.) OUT OF: She took her purse out of her pocket. (Ta võttis taskust rahakoti.) OVER: He climbed over the fence. (Ta ronis üle aia.) PAST: He went past the house. (Ta läks majast mööda.) ROUND: The earth turns round the sun. (Maa tiirleb ümber päikese.) SINCE: I haven't seen her since Monday. (Ma pole teda esmaspäevast saadik näinud.) THROUGH: The river flows through the town. (Jõgi voolab läbi linna.)

Keeled → Inglise keel
9 allalaadimist
Infovoldik maikellukesest
2
doc

Infovoldik maikellukesest

com http://www.purplesage.org.uk http://www.wikipedia.org http://www.wiseacre-gardens.com Elisabeth Viinalass Other names: May Lily, May Bells, Lily Old folk tales claim that Lily of the Valley Caution: Lily of the valley should only be Constancy, Ladder-to-Heaven, Male Lily and protects your garden from evil spirits. Carrying used under the supervision of a qualified Muguet a posy of the flowers is said to improve your herbalist! Scientific classification memory. The flowers were said to cheer the heart and lift the spirits of all those in their Parts used: leaves and flowers; the fresh

Keeled → Inglise keel
10 allalaadimist
Eessõnad
2
doc

Eessõnad

Pinnad (mitte sisemus) from the table (laualt) *on the morning of 1 June (mandrid, riigid, linnad jne.) *on the top floor (kõige ülemisel from work (töölt) (esimese juuni hommikul) *in England (Inglismaal) korrusel) from the library (raamatukogust) *on Sunday morning (pühapäeva *in London (Londonis) *on the shelf (riiulil) off the ladder (redelilt maha) hommikul) *in the country (maal) *on the wall (seinal) off the horse (hobuse seljast maha) MUUD EESSÕNAD MUUD EESSÕNAD

Keeled → Inglise keel
29 allalaadimist
Elektriajamite juhtimine labor 15
5
doc

Elektriajamite juhtimine labor_15

S0062 L X7 S0063 A SY6 S0064 = B0,01 bitt 1 S0065 EP 5. Täiendavad juhised töö läbiviimiseks 1. Valgusfoori talitlust valiva ümberlülitina kasutada üht loogikakontrolleri esipaneelil asuvatest tumbleritest. 6. Järeldus Programmikeelega PL7-1 Grafcet kirjutatud programm on pikem eelpool õpitud PL7-1 Ladder Diagrami vastavast programmikeelest. Koostatud programm töötas vastavuses joonisega 1. Seadmed olid üsna kaasaegsed, nende töös tõrkeid ei esinenud.

Elektroonika → Elektriajamite juhtimine
23 allalaadimist
CPM1A Programmable Controllers Operation Manual 1784470
402
pdf

CPM1A Programmable Controllers Operation Manual 1784470

Read this manual first to acquaint yourself with the CPM1A. The CPM1/CPM1A/CPM2A/CPM2C/SRM1(-V2) Programming Manual (W353) provides detailed descriptions of the CPM1A’s programming functions. The SYSMAC Support Software Operation Manu- als: Basics and C-series PCs (W247 and W248) provide descriptions of SSS operations for the CPM1A and other SYSMAC C-series PCs. The SYSMAC-CPT Support Software Quick Start Guide (W332) and User Manual (W333) provide descriptions of ladder diagram operations in the Windows environment. The WS02-CXPC1-E-V72 CX-Programmer Ver. 7.2 Operation Manual (W446) and the WS02-CXPC1-E-V7 CX-Programmer Ver. 7.2 Operation Manual: Function Blocks/Structured Text (W447) provide details of operations for the WS02-CXPC1-E CX-Programmer. The CompoBus/S Operation Manual (W266) pro- vides CompoBus/S communications specifications and describes CompoBus/S application methods.

Tehnika → Automatiseerimistehnika
9 allalaadimist
John Travolta
4
odt

John Travolta

Born in: Englewood, New Jersey Nationality: American Career: Hollywood Actor Height: 6' 2'' (1.88m) John Travolta is one of the highly successful actors in Hollywood, who made an impact even after a string of flops. John Travolta is known for his dancing and singing skills as well. His ''never say die'' spirit pulled him through the toughest times in his life. Credited with some blockbuster hits like Saturday Night Fever, Grease, Pulp Fiction, Look Who's Talking, Face Off, Ladder 49, etc. John Travolta is definitely one of the most respected actors in Hollywood. Childhood and Early Years John Travolta was born John Joseph Travolta on February 18, 1954 in Englewood, New Jersey. His father was a semi-professional football player turned tire salesman named Salvatore Travolta and was from Italian American descent. Helen Cecilia was his mother and was an actress and singer, who acted and directed before becoming a high school English and drama teacher

Keeled → Inglise keel
5 allalaadimist
Kokkuvõte Oscar Wilde
1
rtf

Kokkuvõte Oscar Wilde

Hugh the Miller always went to Hans's house in order to recollect flowers for himself. Hugh the Miller always talked about how important is friendship and to share everything with one's friends, but he never gave anything to Hans. Hans always worked in his garden, but in winter he felt lonely and lived in bad conditions because of the cold weather, and because anyone visited him. One night, The Millar went to see Hans with a lantern and a big stick because his son has fallen off a ladder and he wanted Hans to go to call the Doctor. However, he didn't want to give Hans the lantern because he said it was new.

Keeled → Inglise keel
5 allalaadimist
AJAMÄÄRUSES ESINEVAD EESSÕNAD
3
docx

AJAMÄÄRUSES ESINEVAD EESSÕNAD

(Ta jäi sinna kolmeks päevaks.) FROM: I took it from the box. (Võtsin selle kastist.) IN: In summer they stayed in town. (Suvel jäid nad linna.) IN FRONT OF: He stopped in front of the house. (Ta peatus maja ees.) INSIDE: They are inside the house. (Nad on majas.) INTO: Let him into the house. (Lase ta majja.) NEAR: Our house is near the postoffice. (Meie maja on postkontori ligidal.) OF: He bought a bar of chocolate. (Ta ostis tahvli okolaadi.) OFF: Dick fell off the ladder. (Dick kukkus redeli pealt maha.) ON: Put it on the table. (Pane see lauale.) OUT OF: She took her purse out of her pocket. (Ta võttis taskust rahakoti.) OVER: He climbed over the fence. (Ta ronis üle aia.) PAST: He went past the house. (Ta läks majast mööda.) ROUND: The earth turns round the sun. (Maa tiirleb ümber päikese.) SINCE: I haven't seen her since Monday. (Ma pole teda esmaspäevast saadik näinud.) THROUGH: The river flows through the town. (Jõgi voolab läbi linna.)

Keeled → Inglise keel
8 allalaadimist
Elektriajamite juhtimine labor 13
5
doc

Elektriajamite juhtimine labor_13

1. Termorelee kontakti ja spindli töö stimuleerivad loogikakontrolleri esiplaanil asuvate tumblerite abil. 2. Potensiomeetrilise sõlme seadistamisel tuleb silmas pidada,et sagedusmuunduri klemmi PL pinge + 15V, sisendile El võib aga maksimaalselt sisestada + 10 V. 6. Järeldus Õppisime kasutama Programmeeritavat loogikakontrollerit TSX 1720, kasutades programmeerimiskeelt PL7-1 Grafcet. Programmikeelega PL7-1 Grafcet kirjutatud programm on pikem eelpool õpitud PL7-1 Ladder Diagrami vastavast programmikeelest. Seekord oli töö võrreldes eelmistega tunduvalt keerulisem, samuti kasutasime reaalselt sagedusmuundurit (ATV 15), induktiivandurit, potensiomeetrite paneele, lõpplüliteid, ning asünkroonmootorit, millede abil saime skeemi tööle vastavuses tööülesandega ja juhtimisalgoritmi plokkskeemiga. Samuti saime vägahea ettekujutuse ettenihkeajami juhtimise programmeeritava loogikakontrolleri abil, ning praktilise kogemuse.

Elektroonika → Elektriajamite juhtimine
25 allalaadimist
Praktikaorganisatsiooni tutvustus
3
docx

Praktikaorganisatsiooni tutvustus

iseloomust ja ulatusest 3)teadvuseta kannatanu esmaabi4)baaselustamine5)verejooksud6)sokis olev haige 7)luumurrud, põletused ja elektritraumad8)kannatanute transportimine Kohustused tegutsemisel eri olukordades ja häiresignaalid Signaliseerimisvahendid ja nende kasutamine (pürotehnilised vahendid, EPIRB ja SART)5.2.5 Laeva sisesidevahendite ja alarmsüsteemide kasutamine 5.2.6Tormitrepi kasutamine (pilot ladder) 5.2.7Tegutsemine kollektiivpäästevahendi meeskonnas 5.2.8 Tegutsemine sildumis-ja haalamisoperatsioonidel 5.2.9Käsklused eesti ja inglise keeles: ankrusse jäämiseks, sildumisel 5.2.10Tekitööd ja neis kasutatavad tööriistad 5.2.11Ohutustehnika tundmine laevatöödel 5.2.12Üldteadmised lastist VAHIMADRUS II Vahimadrus II kutsekvalifikatsioon sisaldab lisaks madrus I kutseoskusnõuetele alljärgnevat:5.3 Põhioskused ja teadmised 5.3

Muu → Praktika aruanne
21 allalaadimist
Kontrolltöö 8-klassile-ILE 6-Unit 2
3
rtf

Kontrolltöö 8. klassile (ILE 6) Unit 2

number will begin. Other players follow in turn from left to right. 2 All players begin at the square number 1. 3 Players throw the dice in turn and move their playing pieces according to the number shown on the dice. 4 Each player has only one turn at a time. 5 Players are not allowed to move to a square which is taken by another player. If this happens, the player must return to the square where they began their move and lose their turn. 6 When a player lands on a square at the bottom of a ladder, the player moves down the snake and places the playing pece on the square with snake´s tail- end. 8 The first player to reach the square numbered "100" is the winner. 1 What do you need to play the game? To play the game you need 4 playing pieces, 2 dice, and a game board. 2 Who will start the game? The player with the highest number. 3 Where do you start the game? At square one. 4 When it´s your turn, how many times can you throw the dice? You can throw the dice only one time.

Keeled → Inglise keel
26 allalaadimist
The Count of Monte Cristo
1
doc

The Count of Monte Cristo

enough money and power to carry out revenge on his enemies. Faria is the first person that opens up Dantes' eyes so that he can see who his enemies really are. When Dantes first meets Faria, he is overjoyed because he hasn't seen another person, other than the guard, for years. Faria reaches Dantes by means of a tunnel that took him 3 years to dig with his makeshift tools. Even though he had limited resources, Faria made matches, a lantern, a ladder, and a knife. Faria hid all these tools behind two separate rocks in his cell. All of these things show how smart Faria really was. Faria's intelligence is what helps Dantes make his transformation. "There is a maxim of jurisprudence which says, `If you wish to discover the guilty person, first find out to whom the crime might be useful.' To whom might your disappearance be useful?" This quote makes it apparent to Dantes that it wasn't just a big accident that he went to jail

Keeled → Inglise keel
22 allalaadimist
Housing
11
pptx

Housing

which the front door opens. With its own door, through which people pass before getting to the hall­an extra line of defence! The back door is for family and close friends only. Owning and renting The desire to own the place where you live is almost universal in Britain. However, house prices are high. This dilemma is overcome by the mortgage system. More and more of the people who dont already own a house simply cant get their feet on even the lowest rung of the ladder. Owning was made easier by government policies which offered people various kinds of financial assistance to help them do so. There are organizations which run their properties like a business but are obliged to run them for social benefit. Homelessness Number s of people who have nowhere to live vary, but at the present time they probably stand between a quarter and a half million. All reasons amout to the simple fact that there isnt enough affordable accommodation for them.

Keeled → Inglise keel
6 allalaadimist
Praktiline töö - SDS-PAGE PROTEOOMIKA
12
doc

Praktiline töö - SDS-PAGE PROTEOOMIKA

3. Jahutasime valguproovid jäävannis. 4. Raputasime eppendorvid, et saada valgutilgad põhjale. Foreesiaparati asetamine: Proovide jahutamise ajal asetsime geel foreesiaparaati. Seleks täidsime puhvrikambrid jooksupuhvriga (0,25 M TRIS, 1,92 M glütsiin, 0,1% SDS, pH 8,3) ning eemaldasime kammi. Forees: 1. Igasse taskusse kandsime 20 µl valguproovi. Viimasse taskusse panime 3 µl foreesredeli - Thermo Scientific PageRuler Unstained Broad Range Protein Ladder. 2. Asetasime foreesivannile kaas, ühendasime juhtmed vooluallikaga ning lülitasime vooluallikas sisse (pinge 150V, voolutugevus 30 mA). 3. Jätsime foreesiaparaati üheks tunniks kuni markerina kasutatav broomfenoolsinine on geeli lõpuni jõudnud. 4. Lülitasime foreesiaparaati elektrivõrgust välja, kogusime puhvrivannidest puhver kokku ja valasime tagasi puhvri pudelisse. 5. Võtsime geeli aparaadist välja, ettevaatlikuslt eraldasime klaasplaadid teineteisest. 6

Bioloogia → Genoomika ja proteoomika
40 allalaadimist
Kontroller FC34
20
doc

Kontroller FC34

LSV INT loenduri seadeväärtus e kordade arv LHV INT loenduri hetkeväärtus QL BOOL lipp, mis annab märku et vajalik arv kordi on väljas käidud INIT BOOL lipp mis annab märku, et süsteem on initsialiseeritud KORD BOOL lipp, mis annab märku, et silinder on korra väljas käinud RESETLOE BOOL lipp mis resetib loenduri 16 LD Ladder Diagram 17 Elektriline skeem Põhimõtteline elektriskeem 18 Kokkuvõte Õppisin kasutama viite kontrolleri programmeerimise keelt. Samuti õppisin programmi ning algorütmi koostamist. Minu jaoks oli kõige lihtsamad keeled SFC. ST ja LD ning SFC ja FBD keeles programmi koostamine võttis kõige rohkem aega. Sain ettekujutuse kontrolleri töö põhimõtetest ning nende vajalikkusest. Oskan kasutada programmi simulatsiooni, oskan

Informaatika → Algoritmid ja andmestruktuurid
11 allalaadimist
Laboratoorne töö nr 11
8
doc

Laboratoorne töö nr 11

S0035 R O0,02 Tuli 2 kustub (L2) S0036 EP 3. Sisestada koostatud programmid loogikakontrollerisse. 4. Kontrollida sammhaaval sisestatud programme, vajadusel parandada vead. 5. Koostada vajalik installatsiooniskeem. 6. Lülitada loogikakontroller talitlusse ,,RUN" ja veenduda, et programm täidab talle püstitatud ülesandeid. Hinnang tehtud tööle. Selles töös kasutasime programmeerimiskeelt PL7-1 Grafcet, mille kood tuli tunduvalt pikem kui Ladder Diagrammis. Samuti isiklikult meile tundus PL7-1 Grafcet's koodi kirjutamine palju raskem.

Elektroonika → Elektriajamite juhtimine
31 allalaadimist
Frank Zappa-Pink Floyd Phil Collins-Peter Brian Gabriel-Briti ansambel Genesis-Emerson-Lake & Palmer ELP- Yes
3
doc

Frank Zappa, Pink Floyd,Phil Collins, Peter Brian Gabriel, Briti ansambel Genesis, Emerson, Lake & Palmer(ELP), Yes

aasta jooksul oma sooloplaatide tegemisele. 1977. aastal tuli Yes jälle oma klassikalises koosseisus kokku ning andis välja albumi ,,Going For The One". Ning seda peetakse siiani õigustatult Yesi teiseks n-ö megaplaadiks varasema ,,Close To The Edge'i" kõrval. 1978. aastal ilmunud ,,Tormato" jäi lihtsalt ,,Going For The One'i" varju. Tõsi, edukaks osutus aastal 1983 ilmunud stiilipöördeline plaat ,,90125" Viimased plaadid Big Generator" , ,,Union" , ,,Talk",, ,,The Ladder" ja ,,Magnification" olid küllaltki tagasihoidlikud.

Muusika → Muusika
16 allalaadimist
Gymnastics
21
pptx

Gymnastics

and young men on apparatus they had designed that ultimately led to what is considered modern gymnastics. Don Francisco Amoros y Ondeano, marquis de Sotelo, is born on february 19th 1770 in Valence and died on august 8th 1848 in Paris he was a spanish colonel, the first one to introduce educative gymnastic in France. He created the first military and civil gymnasium in Paris. In particular, Jahn crafted early models of the horizontal bar, the parallel bars (from a horizontal ladder with the rungs removed), and the vaulting horse. Events for men Floor Male gymnasts also perform on a 12m. by 12m. spring floor. A series of tumbling passes are performed to demonstrate flexibility, strength, and balance. The gymnast must also show strength skills, including circles, scales, and press handstands. Men's floor routines usually have four passes that will total between 60­70 seconds and are performed without music, unlike the women's event. Rules require that

Keeled → Inglise keel
8 allalaadimist
Inglise keele kirjapraktika portfoolio
6
doc

Inglise keele kirjapraktika portfoolio

I only wish I could share more of it with you guys. I miss you all so much. Lots of love and kisses to everyone! Love Regina 3. Descriptions a) an object My bed in the dormitory is a bunk bed. It is a huge old light brown wooden piece of furniture. It squeaks when I switch sides or when I climb into it. I sleep on the second level and sometimes I am truly scared for my life. It is not as sturdy as I would like it to be. The bottom step on the ladder is loose and I know that one night I am going to fall thanks to that. It has carvings, but they are all scribbles made by previous sleepers. The mattress is worn out and needs to be replaced. It is stained beyond sense. At least it has not fallen apart, yet. b) a place Lausanne is a city in Switzerland which took my breath away, literally. It is one of the most beautiful places I have seen and it is simply filled with history.

Keeled → Akadeemiline inglise keel
4 allalaadimist
Inglisekeelne majandusalane sõnastik
12
docx

Inglisekeelne majandusalane sõnastik

412. Salivate- sülge eritama 413. Sanctioned - sanktsioonid 414. Scams ­ pettused 415. Schedule- ajakava, sõiduplaan 416. Scheme- skeem, kava, joonis 417. Scold- pragama 418. Seek- otsima, püüdlema 419. Sensible- arukas, praktiline 420. Service- teenus 421. Settled- lahendatatakse 422. Shareholder- aktsionär 423. Shares- aktsiad 424. Sheets- lehed 425. Shopkeeper- poe omanik 426. Simply- lihtsalt 427. Soar- kõrgustesse tõusma 428. Social ladder ­ Sotsiaalne redel 429. Software- tarkvara 430. Speculate- oletama, arvama 431. Sprung up- tärkama 432. Spur- kannustama 433. Staggering- vapustav, tuikuma panev 434. Stake- osak 435. Stakes ­ panused 436. Startling- ehmatav, jahmatav 437. Stated policy- kindlaksmääratud poliitika 438. Statistic ­ statistika 439. Steep ­ järsk 440. Stem- tüvi 441. Stock- aktsia, kaubavaru, tagavara 442. Stock exchange- väärtpaberibörss 443. Stole- vargus 444

Keeled → Inglise keel
29 allalaadimist
Automatiseerimistehnika vaheeksam II kordamisküsimused vastustega
42
doc

Automatiseerimistehnika vaheeksam II kordamisküsimused vastustega

Sisend-väljundsüsteem ei ole mõeldud suurtele vooludele ja seadmete otsejuhtimiseks. Kõrgsageduslike signaalide töötlemiseks on spetsiaalsed moodulid, mis summeerivad impulsside arvu, arvutavad impulsside sageduse ning edastavad tulemused andmesidesiini kaudu protessorile. Kommunikatsioonimoodulid on mõeldud kontrollerite omavaheliseks ja operaatorseadmetega andmevahetuseks. 17. Juhtalgoritmide esitamise viisid 1. programmeerimine kontakt(relee)skeemina (LD – Ladder diagram) – programmeerimisel releeskeemina kujutab juhtimisprogramm endast lihtsamal juhul ekeltriskeemi analoogi, kus skeemi vasakpoolne siin on piltlikult ühendatud toiteallikaga ja parempoolne siin korpusega, ning nende vahel on ühendatud elektriahelad. Võimaldab esitada keerukaid algoritme ning seda on mugav kasutada tarbijatel, kes on harjunud lugema ja koostama releeautomaatikaskeeme. 2. Käsulistina programmeerimine kujutab endast madaltaseme keeles programmeerimist

Tehnika → Automatiseerimistehnika
193 allalaadimist
Public Administration and Innovation
26
docx

Public Administration and Innovation

efficient by forcefully restructuring them. By now it is clear that this will not be enough. The state has realised that it needs to limit the economy’s dependence on large companies. Also, in order to stay competitive, there needs to be a general shift away from hardware and towards services. (Mundy, 2014) •There have been government initiatives launched to foster the start-up model of business, especially when it comes to funding (the largest financing mechanism is Growth Ladder Fund, with about $2.7bn in assets), but generally the regulatory and business environment is still considered too rigid, conservative and geared towards large conglomerates to bring about any substantial change. (Jung-a, 2014)

Varia → Public Administration
5 allalaadimist
Pay-for performance-necessary or unsuitable way to increase efficiency in the public sector
18
pdf

Pay-for performance: necessary or unsuitable way to increase efficiency in the public sector

So in very banal way we could say that if we pay more, or extra for civil servants they will do better decisions and they will work better. (Of course I believe that they should be doing this either way serving public interest). Other positive effects that pay-for performance has is that it would allow managers to weed out less effective employees. It would help to set hierarchy- and based on that reward employees more who are higher level and less those who are on a lower level of the ladder. In a way it helps to serve the idea of cost-effectiveness, when less productive workers get less paid. It is also believed that it helps to reduce cost on annual salary rise and pension system giving more open playground. For managers and to general public it would also give a view of who is responsible for good or bad performance. Cost- effectiveness is the main benefit that pay-for performance brings. Another positive side of this is believed to be idea, that it will make public sector

Keeled → Inglise keel
3 allalaadimist
Liikurmasinate erialane inglise keel
22
doc

Liikurmasinate erialane inglise keel

Roostes 24. Island sides 24. Ohutussaared 25. Jack 25. Tungraud 26. Jenny 26. Vints, liikuv tõstekraana 27. Joint 27. Vuuk, ühendama 28. Jointing compound 28. Vuugitäitemass 29. Junction 29. Ristmik, liiklussõlm 30. Kirk 30. Kirka LMN vocabulary 1. Labour force 1. Tööjõud 2. Ladder dredge 2. Paljukopaline ekskavaator 3. Lam 3. Liivsavi 4. Lamp post, lamp pole 4. Laternapost 5. Land clearing blade, Land grader 5. Võsalõikaja 6. Lane-change 6. Rajavahetus 7. Large ballast 7. Jämekillustik 8. Leaf spring 8. Lehtvedru 9. Leak (age) 9. Leke 10. Left hand traffic 10. Vasakpoolne liiklus 11

Keeled → Inglise keel
7 allalaadimist
Inglise keele eessõnad
6
txt

Inglise keele eessõnad

(Ta ji sinna kolmeks pevaks.) FROM: I took it from the box. (Vtsin selle kastist.) IN: In summer they stayed in town. (Suvel jid nad linna.) IN FRONT OF: He stopped in front of the house. (Ta peatus maja ees.) INSIDE: They are inside the house. (Nad on majas.) INTO: Let him into the house. (Lase ta majja.) NEAR: Our house is near the postoffice. (Meie maja on postkontori ligidal.) OF: He bought a bar of chocolate. (Ta ostis tahvli okolaadi.) OFF: Dick fell off the ladder. (Dick kukkus redeli pealt maha.) ON: Put it on the table. (Pane see lauale.) OUT OF: She took her purse out of her pocket. (Ta vttis taskust rahakoti.) OVER: He climbed over the fence. (Ta ronis le aia.) PAST: He went past the house. (Ta lks majast mda.) ROUND: The earth turns round the sun. (Maa tiirleb mber pikese.) SINCE: I haven't seen her since Monday. (Ma pole teda esmaspevast saadik ninud.) THROUGH: The river flows through the town. (Jgi voolab lbi linna.)

Keeled → Inglise keel
53 allalaadimist
English literature
4
doc

English literature

But as there had been an inanimate class, so to balance it there must be a purely rational or spiritual one: the angels. Every class in the chain may excel in a single particular. Beasts are stronger than men, men have the power of learning (angels don't). Within every class there is the most excellent specimen the dolphin-fishes, the eagle-birds, the lion-beasts, the emperor-men, God- angels, the sun, the justice, the head. The 4 elements (earth, water, air, fire) formed the ladder of the own, the highest-heavenly fire, God. The elements were the material for the whole universe. The air above the moon was considered as the 5 th element, called ether. The angels are arranged in a definitive order, 3 main orders are: highest is contemplative, consists of Seraphs, Chembs and Thrones. Second is more active- Dominations, Virtues, Powers. Third-the most active-Principalities, Archangels, Angels, they form the medium between the angelic hierarchy and man

Keeled → Inglise keel
65 allalaadimist
English portfolio
19
doc

English portfolio

the borders between social class and nationality. The most important category in determining one`s social allegiance was the differentiation Deutsch and Undeutsch. Nor did rural Estonians think of themselves as a nation: they rather considered themselves peasants whose identity was largely influenced by regional loyalty. The name they often used while referring to themselves -- "country people" -- also seemed to be a sign of social self- determination. Climbing the social ladder in a society with a fixed class system was possible only for the very few. For an Estonian, this automatically meant Germanisation. Such a process of individuals revising their ethnic adherence, which had begun in the Middle Ages and continued until the early 20th century. Serfdom and the intensifying manorial economy The impact of the Swedish social order in Estonia continued under the Russian Empire. Although the Northern War meant a severe setback to the development of schools, the

Keeled → Inglise keel
38 allalaadimist
Molekulaar- ja rakubioloogia praktikum
34
docx

Molekulaar- ja rakubioloogia praktikum

10/4 = 1/x ehk x = 4/10 = 0,4µl Praktiline töö nr. 3: DNA lahutamine agaroosgeelis Eesmärk: PCR produkti lahutamine geelelektroforeetiliselt. Materjalid: 18 µl PCR produkt DNA, mida visualiseerima 3,6 µl DNA laadimispuhver DNA visualiseerimiseks ja paremini hambasse vajutamiseks. TAE agaroosgeel GeneRuler 100bp Plus Marker DNA fragmentide pikkuse ning Ladder koguae ligikaudseks kvantifitseerimiseks Arvutused: Meil on 20 µl PCR produkti, kust võeti 2 µl ära. DNA laadimispuhvri koguse jaoks teeme arvutuse: 18/5 =3,6 µl Töö käik:  Pipeteerin PCR segule 6x DNA laadimispuhvri.  Pipeteerime markeri geeli esimesse hambasse.  Pipeteerin enda segu geeli hambasse.  Lahutame DNA geelis elektrivoolu toimel (150V ja laseme joosta 20 minutit)

Bioloogia → Molekulaar- ja rakubioloogia...
104 allalaadimist
Inglise keele variandid-Varieties of English
15
doc

Inglise keele variandid (Varieties of English)

Generally speaking the standard forms of Canadian and modern American English are alike. Particularities in pronounciation: (special features) · Canadian Raising ­ (found in lexical sets: price, mouth) Before voiced consonants: Diphtongs /aI/ /a/ would be pronounced more like /i/ /I/ and //. · Absence of distinction between cot/caught ­ pronounced alike, with an a (close to AmEng) · T - flapping and T ­deletion. Sound /t/ between vowels will be pronounced as /d/ - (water, ladder, latter) = T-flapping. When the /t/ is deleted, usually after /n/ - (winter, (,,winner"), interesting (,,ineresting")) ­ we are dealing with = T-deletion · Schedule, hostile and some other words are pronounced depending on social variation and region. (Great degree of influence from AmEng) · Again(st), sometimes /gen/, sometimes /geIn/ · Been [bin] · Shone ­ [sho:n] follows BrEng variant · Tomato [tomæto] different from both AmEng and BrEng Grammar:

Keeled → Inglise keel
51 allalaadimist
Käänded Euroopa keeltes
46
doc

Käänded Euroopa keeltes

(`Ta jäi sinna kolmeks päevaks.') FROM: I took it from the box. (`Võtsin selle kastist.') IN: In summer they stayed in town. (`Suvel jäid nad linna.') IN FRONT OF: He stopped in front of the house. (`Ta peatus maja ees.') INSIDE: They are inside the house. (`Nad on majas.') INTO: Let him into the house. (`Lase ta majja.') NEAR: Our house is near the postoffice. (`Meie maja on postkontori ligidal.') OF: He bought a bar of chocolate. (`Ta ostis tahvli sokolaadi.') OFF: Dick fell off the ladder. (`Dick kukkus redeli pealt maha.') ON: Put it on the table. (`Pane see lauale.') OUT OF: She took her purse out of her pocket. (`Ta võttis taskust rahakoti.') OVER: He climbed over the fence. (`Ta ronis üle aia.') PAST: He went past the house. (`Ta läks majast mööda.') ROUND: The earth turns round the sun. (`Maa tiirleb ümber päikese.') SINCE: I haven't seen her since Monday. (`Ma pole teda esmaspäevast saadik näinud.') THROUGH: The river flows through the town

Keeled → Keeleteadus
7 allalaadimist
Molekulaarbioloogia praktikumi protokoll
18
doc

Molekulaarbioloogia praktikumi protokoll

suuda neid enam detekteerida, kui restriktaasiga lõikame. Lähteained: ­ Rekombinantne DNA (~100 ng/l) ­ Restriktaas Cfr42I (SacII) (10u/l, Fermentas; http://www.fermentas.com/; vt lisa) ­ Restriktaasi 10 x puhver (lisatakse 1/10 reaktsiooni mahust) ­ Agaroos (FMC) ­ 1 x TBE foreesi puhver (TBE, 50 mM Tris-boraat, pH 8,3; EDTA-Na2) ­ 1 x TBE foreesi pealekandmis-puhver ­ Molekulmassi marker (DNA, 1 kb või 100 bp "ladder"; 100-200 ng raja kohta) ­ H2O ­ 10 x PCR puhver (Fermentas) ­ 25 mM MgCl2 ­ Taq DNA polümeraas, 5 u/l (Fermentas) ­ 2 mM dNTP (Fermentas) ­ T3 ja T7 RNA polümeraasi promootori praimerid AATTAACCCTCACTAAAGGG ja TAATACGACTCACTATAGGG, 100 ng/l Töö käik: A: Restriktsioon ei tee (1) Saadud rekombinantse DNA restriktsiooniks Cfr42I-ga: võta ~500 ng miniprep DNA-d (5 l), lisa 4 l H2O-d ja 1 l 10 x puhvrit (kokku 10 l). Jaga lahus kahte tuubi (5 l mõlemasse), ühte lisa

Bioloogia → Molekulaarbioloogia
31 allalaadimist
Kubism
8
docx

Kubism

During World War II Léger lived in the United States, where he found inspiration in the novel sight of industrial refuse in the landscape. The shock of juxtaposed natural forms and mechanical elements, the "tons of abandoned machines with flowers cropping up from within, and birds perching on top of them" exemplified what he called the "law of contrast".[14] His enthusiasm for such contrasts resulted in such works as The Tree in the Ladder of 1943-44, and Romantic Landscape of 1946. A major work of 1944, Three Musicians (Museum of Modern Art, New York), reprises a composition of 1930. A folk-like composition reminiscent of Rousseau, it exploits the law of contrasts in its realistic juxtaposition of the three men and their instruments. Stained-glass window at the Central University of Venezuela, c.1950s Upon his return to France in 1945, he joined the Communist Party. During this period his

Kultuur-Kunst → Kunstiajalugu
40 allalaadimist
Molekulaarbioloogia protokoll
16
docx

Molekulaarbioloogia protokoll

PCR-ga analüüsida. Inserdi suuruse määran restriktsiooni teel. Lähteained: ­ Rekombinantne DNA (~100 ng/l) ­ Restriktaas Cfr42I (SacII) (10u/l, Fermentas; http://www.fermentas.com/; vt lisa) ­ Restriktaasi 10 x puhver (lisatakse 1/10 reaktsiooni mahust) ­ Agaroos (FMC) ­ 1 x TBE foreesi puhver (TBE, 50 mM Tris-boraat, pH 8,3; EDTA-Na2) ­ 1 x TBE foreesi pealekandmis-puhver ­ Molekulmassi marker (DNA, 1 kb või 100 bp "ladder"; 100-200 ng raja kohta) ­ H2O ­ 10 x PCR puhver (Fermentas) ­ 25 mM MgCl2 ­ Taq DNA polümeraas, 5 u/l (Fermentas) ­ 2 mM dNTP (Fermentas) ­ T3 ja T7 RNA polümeraasi promootori praimerid AATTAACCCTCACTAAAGGG ja TAATACGACTCACTATAGGG, 100 ng/l Töö käik: A: Restriktsioon (1) Restriktsioon: 1) 20 µl plasmiidsed DNA-d 22 µl 2) 2 µl 10x restriktaasi puhvrit Saadud 22 µl lahust jagan kaheks tuubiks, mõlemad 11 µl

Bioloogia → Molekulaar- ja rakubioloogia...
103 allalaadimist
Suuline eksam
15
doc

Suuline eksam

Stool Taburet Bedside table Öökapp Pot plant Toalill Dressing table Peeglilaud Window sill Aknalaud Wardrobe Riietekapp Rug vaibake Wallpaper Tapeet Balcony Rõdu Needle Nõel Bucket Ämber Thread Niit, lõng Ladder Redel Scissors Käärid Vacuum cleaner Tolmuimeja Axe Kirves Hammer haamer Hoe Kõbla Screwdriver Kruvikeeraja Ruler Joonlaud Paper clip Kirjaklamber Saw Saag Rake Reha Broom Luud

Keeled → Inglise keel
588 allalaadimist
English Grammar Book 1
159
pdf

English Grammar Book 1

mall zoo 10 These are words for things. They are common nouns. basket bed drum cake blanket Word File Here are more words for things: bag kite box ladder bread lamp can picture chair radio cot television cup train desk truck door watch gate egg window 11 Exercise 1 Underline the common nouns in these sentences

Keeled → Inglise keel
193 allalaadimist
The Rise and Demise of the New Public Management-28 10
15
docx

The Rise and Demise of the New Public Management, 28 10

presented on 21 December 2004. Some parts have been adapted from Drechsler 2005a, 2004, and 2003. Helpful comments on the current version by Ingbert Edenhofer, Rainer Kattel, Dennis Ch. Pachernegg, Erik S. Reinert, and Eugenie Samier, as well as funding from ETF5780, are gratefully acknowledged. References Carroll, Lewis (1865). Alice's Adventures in Wonderland. E.g. in Heath 1974. Chang, Ha-Joon (2002). Kicking Away the Ladder. Development Strategy in Historical Perspective. London: Anthem. Doornbos, Martin (2004). "`Good Governance': The Pliability of a Policy Concept." Trames 8(4): 372-387. Drechsler, Wolfgang (2005a). "The Re-Emergence of `Weberian' Public Administration after the Fall of New Public Management: The Central and Eastern European Perspective." Halduskultuur 6: 94-108. On the net at http://deepthought.ttu.ee/hum/halduskultuur/Wolfgang%20Drechsler%2094- 108.pdf.

Ühiskond → Avalik haldus
16 allalaadimist
Elektriajami juhtimine
158
pdf

Elektriajami juhtimine

plokis. Sõltuvalt sisendplokist saadud infole saab protsessor programmi põhjal otsustada, millise väljundi olekut tuleb väljundplokis muuta. Protsessor käib tsükliliselt läbi kõik programmimällu kirjutatud käsud. PLK programmeerimiseks kasutatakse rahvusvahelise standardiga IEC 61131 määratud programmeerimisviise (joonis 5.9): Joonis 5.9 kontaktaseskeemi Ladder Diagram (LD) või Ladder Logic (LAD); algoritmi plokkskeemi ehk sammprogrammi Sequential Function Charts (SFC); loogikaskeemi Function Block Diagram (FBD); C++ või Pascal´i sarnast kõrgkeelt Structured Text (ST); käsulisti Instruction List (IL) või Statement List (STL). Ülaltoodu näitlikustamiseks vaatleme elektriajami programmjuhtimist loogika- kontrolleri TSX17 abil. Juhtimisülesanne on järgmine.

Elektroonika → Elektriaparaadid
99 allalaadimist
Book Analog Interfacing to Embedded Microprocessors
568
pdf

Book Analog Interfacing to Embedded Microprocessors

processor speed, system cost, and ease of manufacture. 12 Analog Interfacing to Embedded Microprocessors Digital-to-Analog Converters 2 Although this chapter is primarily about analog-to-digital converters (ADCs), an understanding of digital-to-analog converters (DACs) is important to understanding how ADCs work. Figure 2.1 shows a simple resistor ladder with three switches. The resistors are arranged in an R/2R configuration. The actual values of the resistors are unimportant; R could be 10K or 100K or almost any other value. Each switch, S0–S2, can switch one end of one 2R resistor between ground and the reference input voltage, VR. The figure shows what happens when switch S2 is ON (connected to VR) and S1 and S2 are OFF (connected to ground). By calculating the resulting series/parallel resistor network, the final

Mehhatroonika → Mehhatroonika
11 allalaadimist
Hispaania keel kirjapilt- audio allalaadimise lingid 53lk
53
pdf

Hispaania keel kirjapilt + audio allalaadimise lingid 53lk

carpet la alfombra iron (flat) la plancha stove la estufa cassette la cinta kerosene el petróleo study el estudio CD player el lector de CD key la llave switch el conmutador ceiling el techo kitchen la cocina table la mesa chair la silla ladder la escalera tap (faucet) el grifo chimney la chimenea lamp la lámpara telephone el teléfono cigar el puro / el cigarro lawn el césped television el televisor cigarette el cigarrillo light bulb la bombilla toaster la tostadora clock el reloj living room la sala toilet (WC) el inodoro

Keeled → Hispaania keel
91 allalaadimist


Sellel veebilehel kasutatakse küpsiseid. Kasutamist jätkates nõustute küpsiste ja veebilehe üldtingimustega Nõustun