# Rundate: Wed Mar 07 18:02:24 2007 # Align_format: srspair # Report_file: /ebi/extserv/old-work/needle-20070307-18022349260605.output ######################################## #======================================= # # Aligned_sequences: 2 # 1: EMBOSS_001 # 2: EMBOSS_001 # Matrix: EDNAFULL # Gap_penalty: 10.0 # Extend_penalty: 0.5 # # Length: 909 # Identity: 405/909 (44.6%) # Similarity: 405/909 (44.6%) # Gaps: 504/909 (55.4%) # Score: 2025.0 # # #======================================= EMBOSS_001 1 atgttgatgattaaaggaattatttttgatatggacggtgttttatttga 50 EMBOSS_001 1 0 EMBOSS_001 51 tacagaacctttttatctgaggcgacgagaagatttttttaagacaaagg 100 EMBOSS_001 1 0
members and is elected for four years, when the British parliament is bicameral and has 1455 members currently and is elected for five years. Bicameral parliament means that there are two separate assemblies. There are quite a few minor differences that Iam not going to mention because otherwise it would take me much longer than two minutes to talk about them. Now i want to talk about similarities. I previously talked about parliaments and that leads me to the first similarity: in both systems the head of the parliament is Prime Minister, current Prime minister in United Kingdom is Theresa May and in Estonia Taavi Rõivas. The second similarity is the election to the parliament in both countries you have to be at least 21 years old and there are some other criterias to match like mental health and imprisonment. And in both countries you have to be at least 18 years old to vote.
Firstly, poetry is popular among girls. About 17% of them are interested in it, but only 9% of the boys are interested in it. Moreover, girls are bigger romantic novels" readers than boys. 34% of girls and only 11% of boys like romantic novels. However, boys are very interested in reading thrillers. When 51% of boys like thrillers, then only 21% of the girls like it. Secondly, it is worth mentioning that there are also one similarity in girls and boys reading interests. The rate of students who love historical novels is pretty much the same. 28% of the girls and the 29 % of boys like to read historical novels. In conclusion it is worth mentioning that boys` and girls` reading interests are very different. The most popular books among the girls are romantic novels and the boys are interested in thrillers. Also, historical novels are quite popular. Thus the librarian should buy mostly romantic novels,
what is more so in particular in addition therefore particularly besides as a result/consequence especially above all accordingly mainly as well (as) consequently Reformulation in the same way because of this/that in other words not only ... but also thus rather Similarity hence to put it more simply equally for this/that reason Expressing an alternative likewise so that alternatively similarly in that case rather correspondingly under these circumstances on the other hand in the same way Deduction the alternative is
Estonia vs. United Kingdom Comparing Estonia to United Kingdom, you can mostly find out the fact that the weathers aren’t so different, from my point of view atleast. Pretty rainy or wet most of the time, moderate winters and pretty average summers. Taking a look at the state systems, we can see that both countries are parliamentary government types, just the difference is that the United Kingdom is a monachry with a queen and Estonia has a president. From an economical standpoint, United Kingdom surpasses Estonia is most sectors, we can take the GDP as an example, when UK stands at 2.629 trillion then Estonia only stands at a low of 38.94 billion. That’s a huge difference, but we should concider another factor. When Estonia stands at the bottom ten of public debt, having one of the lowest ones in Europe then United Kingdom is at the top thirty, with its public debt being 89.30 percent of the GDP. ...
flows and domes from the nineteenth and twentieth centuries. Layered tephra deposits are visible along the northwestern crater rim. Active fumaroles, or steam vents, still exist in the caldera. Archaeology: Pompeii of the East 7.In 2004, scientists discovered the remains of a village, and two adults buried under approximately 3 meters (nearly 10 feet) of ash in a gully on Tambora's flank--remnants of the former Kingdom of Tambora preserved by the 1815 eruption that destroyed it. The similarity of the Tambora remains to those associated with the AD 79 eruption of Mount Vesuvius has led to the Tambora site's description as "the Pompeii of the East." 8. Siin on tabel vulkaanipursetest. Selle peal on võimalik näha Tambora vulkaanipursete võrdlust teiste kuulsate vulkaanidega nagu krakatoa või vesuuv
! Basically cave divers swim and explore there.! Sometimes they also find fish, animal and human bones. And they give these to museums.! The first cave diver in world was Jacques-Yves Cousteau and he dived at Aqua-Lung in 1943.! ! 3.slide! There are so many hazards that can be there. ! First is example get lost in caves. In underground is everything so similarity. Thats why you need guide line (I´ll tell you later what it is exatly). You can´t remember what way did you come or where did you turn right and when left.! Of course, when you dive too deep, you maybe get stucked or your air may run out. So you drown. ! In caves there are in- and outflowing water currents and when they are in no propostion they can be bad for divers. And they may collapse.! You get decommpression sickness if you come too quickly on surface
undermined our ability to effectively confront the real challenges we face from fanatics who may use terrorism against us. Although the term is not officially used by the administration of US President Barack Obama, it is still commonly used by politicians, in the media and officially by some aspects of government, such as the Army's Global War on Terrorism Service Medal. In the meantime, the "war on terror" has gravely damaged the United States internationally. For Muslims, the similarity between the rough treatment of Iraqi civilians by the U.S. military and of the Palestinians by the Israelis has prompted a widespread sense of hostility toward the United States in general. It's not the "war on terror" that angers Muslims watching the news on television, it's the victimization of Arab civilians. And the resentment is not limited to Muslims. A recent BBC poll of 28,000 people in 27 countries that sought respondents' assessments of the role of
sequences. One may think of this process as finding "hot-spots" that BLAST can then use to initiate extensions that might eventually lead to full-blown alignments. For nucleotide- nucleotide searches (i.e., "blastn") an exact match of the entire word is required before an extension is initiated, so that one normally regulates the sensitivity and speed of the search by increasing or decreasing the word-size. For other BLAST searches non-exact word matches are taken into account based upon the similarity between words. The amount of similarity can be varied so one normally uses just the word-sizes 2 and 3 for these searches. iv. Skoorimaatriksite varieerimine kuidas mõjutab varieerimine. Skoori number sõltub kõige rohkem maatriksist, sõltuvalt ülesandest valitakse sobiv skoorimaatriks. Matrix A key element in evaluating the quality of a pairwise sequence alignment is the "substitution matrix", which assigns a score for aligning any possible pair of residues
notices it and the boys all run. Even though Oliver didn’t steal anything he still runs because he is in panic. He is blamed as the thiev and has to go to court. In court, Olivers actual innocense unfolds and he is free to go, but because of his bad health mister Brownlow, the judge, takes him to his place. When Oliver is sick at Brownlow’s house he notices a painting of a beautiful woman on the wall. Mr Brownlow notices a similarity in the woman and Oliver. Oliver and Brownlow become good friends and Brownlow trusts Oliver to go and take the compensation money to the bookstore by himself. When Oliver is on his way to the bookstore, the boys decide that Oliver can’t be lurking around on his own because he knows too much and they bring him back to the shelter, also taking the money and books from Oliver. Oliver is now involved in a planned robbery by Sikes and Fagin. His part is to get
· BABYSIT-babysitter · LIAISE-liaison · ENTHUSE- enthusiasm · ACT-action · QUALIFY-qualifized, qualification · INTEND-intendable · EXTEND-extension, · ACCURATE-accuracy · COMPREHEND-comprehensible · DEPEND-dependent KERMO MAISTE · LONG- Length, lengthen · HARD-harden · HOT- heat · SPELL-spelling · MUSIC-musician, musical · ACCIDENT-accidently · ELECT,DISCUSS-election,discussion · STUPID, SIMILAR- stupidity,similarity · EXIST-existence · APPLY-applicate · AGREE-disagree · DONATE-donation · HAPPY-happiness · ACTIVE-interactive, activity · OPTIC-optician · DESTROY-destoying · SHY-shyness · ARROGANT-arrogance · IMPRESS-impression, impressive · ADDICT-addictive · MORAL-morality · REFUGE-refugee · OBESE-obessety · CURIOUS-incurious · GENEROUS-generously,generate, ungenerous · COMPETENT-competitive, competition, · FANATICAL- fanatically, · INTEGRATE-integrated
contextual meaning and emotional meaning and secondary meaning 1. EPITHET 1. METAPHOR indicates individual 1. ZEUGMA 1. PERIPHRASIS 1. BATHOS based on similarity of 2 evaluation of sth. Logical "to join" w-d is use of longer spoiling the lofty effect. Function notions, hidden comparison attribute is non-evaluative in the same description instead of irony, humour.
S. or to the other countries. It was typically used paying particular attention on militant Islamists and al-Qaeda. Although the term is not officially used by the administration of U.S. President Barack Obama, it is still commonly used by politicians, in the media and officially by some aspects of government, such as the Army's Global War on Terrorism Service Medal. In the meantime, the "war on terror" has seriously damaged the United States internationally. For Muslims, the similarity between the rough treatment of Iraqi civilians by the U.S. military and of the Palestinians by the Israelis has prompted a widespread sense of hostility toward the United States in general. It's not the "war on terror" that angers Muslims watching the news on television, it is the victimization of Arab civilians. And the anger is not limited to Muslims. A recent BBC questioning of 28,000 people in 27 countries which seeks respondents judgement of the role of
In Virittäjä 3, 382-402. Kaivapalu, A. & P. Muikku-Werner 2010. Reseptiivinen monikielisyys: miten suomenkielinen oppija ymmär-tää viroa äidinkielensä pohjalta? In Lähivõrdlusi. Lähivertailuja 20, 6897. Kaivapalu, A. & P. Eslon 2011. Onko lähdekielen vaikutus suomen ja viron omaksumiseen symmetristä? Korpuspohjaisen tutkimuksen tuloksia ja haasteita. In Lähivõrdlusi. Lähivertailuja 21, 132153. Kaivapalu, A. & M. Martin 2012. Perceived and actual similarity in closely related languages. Paper presented at EUROSLA 22 in Poznan September 58, 2012. Klein, H. G. & T.D. Stegmann 2000. EuroComRom Die sieben Siebe: Romanische Sprachen sofort lesen können. Aachen Shaker: Verlag. Kürschner, S., C. Gooskens & R. van Bezooijen. Linguistic determinants of the intelligibility of Swedish words among the Danes. In International Journal of Humanities and Arts Computing 2/1-2, 83-100. Lutjeharms, M. 2007. Processing levels in foreign-language reading. In J
TALLINN UNIVERSITY OF TECHNOLOGY Institute of Informatics Department of Informatics Chair of Foundations of Informatics Similarity Nth Assignment for Data Mining Course IDN0100 Student: Matriculation ID: E-mail: Supervisor: Innar Liiv TALLINN 2013 Preparation:
He lies a lot even though he tries not to. Once he starts, he can't stop. Holden also likes to drink and smoke. Compare yourself to this character (bring out similarities and differences): I think everyone has felt depressed or had a very sad period at some point of their teenage years and this is why I think it is very easy to draw parallels with myself and Holden. Another similarity is that I don't do as well in other classes as I do in English, although the differences aren't that drastic. One of the differences is that I usually tell my parents about my problems because I know they can help me with everything. Did you like this character? Why/why not? I definitely like the character because he seems to be different than others, like a drop of ink in a glass of water
much flashbacks like in the opening scene of ``LA Confidential``, in ``LA Confidential`` the narrator is a news reporter Sid Hudgens (played by Danny DeVito). The use of narrator, as an narrative device, is used in previous Film Noir-s like ``Double Indemnity``, too. The narrator is there to help audience to understand, what is going on and also to sympathise with the anti-hero, to be able to see his point of view and even be on his side. There is more than one similarity between the film I analysed and ``LA Confidential``. The music, during the films is also quite similar, even though they don't have the same music (songs). These films are based on novels which have the same author (James Ellroy). In ``LA Confidential`` there are three cops, who are all after truth but they have all different styles, in ``The Black Dahlia`` there are two cops and it comes out that their reasons to solve the murder are really different (as Lee Blanchard, played by
Fading- an old sense of a word fades away- dies Radiation- a new sense of words are created. Extention of meaning- widened meanings. Generalization Specialization of menaing- means narrowing the meaning. Denotative shift is movement in sideways, a combination of extention and specialization. Nt gossip--godfather and idle talk. Pejoration (worsening of meaning) deterioration Amelioration- improvement of meaning. 14) Metaphor and Metonymy Metaphoe- based upone a perception of similarity. Mouse- computer mouse and quiet as a mouse. Dead metaphore- flowerbed Conduit metaphor-ideas and meanings are objects. Conceptual metaphore- the essence is understaning and experience one kind of thing in terms of the other. Orientational metaphor- happy is up, sad is down. Metonymy- is a word that is not called by its own name but by the name it is assosiated with. Nt hollywood- we know it as a filmindustry but acutally it is a palce name. 15) polysemy and homosemy
1) extension>> godparents in baptism > bosom friends (disappearance of religious restriction) 2) narrowing>> the new sense cannot be applied to godparents with which you are not on friendly terms terms (the missing link is a ‘friendly tie’ = connotative extension becomes a central part of the new sense; sponsorship in baptism implies a friendly tie) 33. Metaphor and metonymy Metaphor…transference based on a perception of similarity between the source and the resulting sense. The use of a word or phrase usually designating a concept of one domain or semantic field (the source domain) used to designate an aspect of another domain). Metaphors are usually stablished on the basis of perceived similarity between the two concepts. Metaphorical extension Viros can be a disease, but also can be a computer program From concrete to abstract Style coming from stylus. Manner of writing. From animal to human
temperature can drop to 0 C, the temperature in rainforest don't drop below 20 C very often. The biggest difference between these two bioms is soil- in temperate rainforest the soil is nutrient-rich(because of the quantity of organic matter on the ground) but in troipcal rainforest, it is infertile, deeply weathered and severly leached. Similar between tropical and temperate rainforest is distributation-both of these bioms are found around the equator. And the other similarity is that their only grow plants that require rain. 10. What is the difference between tallgrass pairie and shortgrass prairie? In shortgrass prairies the rainfall is less frequent and less fertile than in tallgrass prairies. 11. How are animals adapted to life in the biome (temperate deciduous forest, temperate rainforest, temperate grassland, taiga)? Temperate deciduous forest- Animals in temperate deciduous forests have to adapt to changing seasons
erinevused? DNA metülatsioon – tsütosiini kovalentne modifikatsioon, kus vesinik H5 vahetatakse metüülgrupi vastu. Seotud valkude sidumisega DNAle. DNA hüdroksümetülatsioon – tsütosiini H5 vahetatakse hüdroksümetüülgrupi vastu. Hüdroksümetülatsioon on seotud tüvirakkude pluripotentsusega. 9. Why is the classic twin study the perfect natural experiment to distinguish nature (shared genes) from nurture (shared environment)? Similarity for continuous traits in twin pairs can be expressed as twin correlations. How can similarity in dichotomous traits (eg diseases) be expressed in twins? Kuna monosügootsed kaksikud jagavad 100% oma geenidest. Disügootsed kaksikud jagavad keskmiselt 50% oma geenidest. Kui neid võrreldes selgub, et mingi tunnuse osas on monosügootsed kaksikud omavahel sarnasemad kui disügootsed, siis võib järeldada et tunnus on mõjutatud geenide poolt. Kui aga lahutatud
7. Does Article 110 TFEU only prohibits discrimination of the strictly identical products? i.e. different taxation system applicable to the cars or it also applies in relation to the `similar products'? How does the Court determine whether products are similar or not? Refer to the applicable case law Art. 110 DFES prohibits the imposition of higher taxes on goods imported from other EU member states that are similar to domestic ones. To determine the similarity, the EU Court has developed two criteria formal and economic. According to a formal criterion, imported and domestic goods should be classified as belonging to the same category of goods for tax, customs, statistical and other (those might be added afterwards by decision of a court or by any legal case) purposes. The economic criterion is broader. According to him, the similarity and analogy of goods are
g. a person, a plant, an animal...), and their meaning often cannot be transparently guessed from its constituent parts. White-collar. Meaning change A word typically has not one meaning but several. Fading- an old sense of a word fades away- dies; Radiation- a new sense of words are created. Denotative shift is movement in sideways, a combination of extension and specialization. e.g. gossip-- godfather and idle talk. Metaphor and metonymy Metaphor- based upon a perception of similarity. Mouse- computer mouse and quiet as a mouse. Metonymy- is a word that is not called by its own name but by the name it is associated with Hollywood. Meaning restriction and extension. Specialization of meaning- means narrowing the meaning, extended - widened meanings. Generalization. Meaning degradation and elevation Pejoration (worsening of meaning) deterioration. Amelioration- improvement of meaning. Monosemy Word only has one meaning.
Sellise nime sai see häire selle sarnasuse tõttu Münchauseni sündroomile, mis on häire, kus inimene tahtlikult tekitab või mõtleb endale välja haigussümptomeid. Rangelt öelduna tähendab MSBP, et inimesel on Münchauseni sündroom ja see psühhopatoloogia avaldub lapse läbi. Munchaussen syndrome by proxy Munchausen syndrome by proxy (MSP) is an uncommon disorder first described by Roy Meadow in 1977. It was so named because of its similarity to Mun- chausen syndrome, a factitious disorder in which a person intentionally produces or fabricates physical symptoms in him- or herself.' In MSP the symptoms are intentionally produced o r fabricated in a child by a parent, usually the mother MSBP is a syndrome in which perpetrators either harm a child in their care or achieve harm through their insistence on medical tests and treatments for non-existent, fabricated or ecacerbated conditions. Abuse may go
ALLITERATION - alliteration is the repetition of single sounds or groups of sounds (usually word-initial sounds, esp. consonants). Alliteration goes back to Anglo-Saxon poetry that knew no rhyme and did not yet rely on metre. The complete alliteration of Anglo-Saxon poetry is sometimes used for humorous purposes. Alliteration may have its share in producing an ironic effect. Alliteration may convey various shades of meaning. Another function of alliteration lies in connecting words by similarity of sound. The function of alliteration depends on the particular context; its rhythmical value goes hand in hand with the connotations it evokes. The expressive value of separate sounds - it has been noted that the sounds [l, m, n] suggest slowness and peacefulness (M. Boulton): b and p - suggest quickness, movement, triviality, scorn; m, n, ng - provide various effects of humming, singing, music, occasionally sinister; l - suggests
piirkiht boundary layer pirnvöör bulbous bow, bulbouse fore foot plokktegur,täidlustegur block coefficient põiklaine transveres waves propulsiivtegur propulsion coefficient raskuskese center of gravity raskuskiirendus acceleration due to gravity Reynoldsi arv Reynolds number ruutjuur square root sarnasuskriteerium criteria of similarity staatiline rõhk static pressure stabilisaator, õõtsesummuti stabilizer sõlm (kiirus) knot sünteetiline vaik synthetic resin rõhujõud pressure force süvis draft, draught tagavarad store, stock tasakaalustama balance tekkepunkt,rõhupunkt pressure point tihedus density tinavaba tin-free
vaccination against the disease. It is known that only pilated strains of Moraxella bovis can cause IBK in cattle. These are used killed Moraxella bovis cells as component in vaccine and it have been shown to be antigenetic and immunogenic. Vaccine efficacy against pinkeye is 5 very different. The effectiveness of the vaccines depends on the vaccine type, the similarity of the vaccine organism to the challenge organism, bacteria strains and other components to formulate the vaccine. Efforts to develop perfect vaccine is laborious due to the loss of pili during the cultivation. Lipopolysaccharides, outer membrane proteins, lipolytic enzymes and proteases in are also important components in the development of effective acellular vaccines against IBK (Prietoa et al., 2008). Treatment
The lysed. The examples of heterogeneities revealed by direct reactions conducted with 10 or 1 ng of DNA were more variable sequencing are displayed in Figures 1 and 2 for ITS1 and ITS2, than those with 100 ng, the absolute deviations from the mean respectively. The direct sequencing electropherograms obtained values of 100 ng experiments being 1.14% and 2.26%, respec- for a single individual exhibited significant similarity, whereas the tively (Table 1); showing that the amount of template DNA can be similarity decreased noticeably in the case of different individuals. reduced to 1 ng with the experiment still giving reliable results. To elucidate the visible heterogeneity, the amplicons from the Further on we found that the method was sensitive to limiting specimens K1, Pe1, Pe2, R, and V2 were cloned and 12 clones per the amount of starting sponge material, e. g
contemplate, decide, decision, erupt, eruption, general, generic, hono(u)r, hono(u)rable, honorary, igneous, ignite, ignition, ignoble, illiteracy, illiterate, immoral, immortality, ingenious, ingenuity, literacy, literate, literature, meditate, meditation, meditative, memorable, memory, moment, momentary, momentous, moral, morality, nobility, noble, pendulous, peninsular, revise, revision, sex, similar, similarity, temple. Binomials o Gluteus maximus, Homo sapiens, miles gloriosus, Pax Britannica. Inflectional endings retained o Addendum, albumen, apex, area, bacterium/bacteria, cactus, calix, camera, cancer, circus, colossus, complex, data, discus, equilibrium, fauna, flora, formula, fungus, genius, genus, homunculus, honorarium, inertia, interim, latex, locus, medium/media, memorandum,
Yet, there are several reasons to believe that the vision of more stable party system rests on the idea of creating a single ,,party of power" . The features of dominant party strategy Studies of dominant party regimes identify a number of common strategies which help to maintain the dominant party's power. In this work, three main approaches presented by David White (White 2011: 660) shall be discussed. First similarity among dominant parties is their adaptability. Of course, at first the party needs to set a common goal and policies, around what it gathers a strong base of supporters and truly dedicated activists. But in consideration of keeping its control, it must take over a rather convenient position, which leaves enough room for political maneuver. Many scholars have argued that the most popular policy position typically centrist attract the parties with
They use it more sparingly, yet FGI 1081 Stylistics (I. Ladusseva) 11 rather frequently and effectively. The complete alliteration of Anglo-Saxon poetry is sometimes used for humorous purposes. Further on, alliteration may have its share in producing an ironic effect. Alliteration may convey various shades of meaning. Another function of alliteration lies in connecting words by similarity of sound. The function of alliteration depends on the particular context; its rhythmical value goes hand in hand with the connotations it evokes. There are attempts to define the expressive value of separate sounds. It has been noted, for instance, that the sounds [l, m, n] suggest slowness and peacefulness. An exhaustive study of consonants and some consonant clusters has been conducted by M. Boulton who claims the following:
.. In the middle/centre there is/are ... At the top/At the bottom there is/are ... On the left/right there is/are ... Behind/In front of... you can see ... Between... there is ... Kui sa räägid inimeste tegemistest pildil, kasuta present progressive (kestev olevik) ajavormi: The woman is watching TV, the man is listening to the radio. Räägime sarnasustest: The most striking/obvious similarity is that ...... Is similar to The first picture is similar to the other. Both Both pictures are about being a parent. Similarly In the same way Likewise Räägime erinevustest: The main/greatest/most important/most significant difference between the pictures is that...... In the first picture, ..... whereas/while/but in the second one ..... On one hand ..... on the other hand...(ühelt poolt, teiselt poolt)
Jakobson Jakobsoni algseks uurimusalaks on nagu Praha ringile kohane eelkõige foneetika. Fonoloogia arenemine ajas. Erinevalt de Saussure'ist peab tema vajalikuks näha seost foneemide ja tähistaja vahel. Jakobson toob ära kaks aspekti: · Tähistaja ja tähistatava seost nimetab ta külgnevuseks(contiguity) ning see baseerub välisel faktoril. · Seos sarnasuse (similarity) põhjal on tingitud keele sisemisest faktorist. Nendest lähtuvalt võib igas keelelises märgis välja tuua kaks operatsiooni liiki : · Kombineerimine -- Iga märk koosneb osamärkidest ja/või esineb ainult ühenduses teiste märkidega. St, et iga lingv. ühik on üheaegselt kontekstiks lihtsamatele ühikutele (helidele, mis sõna moodustavad) ning/või leiab oma konteksti keerukamas lingv. ühikus (sõna lause kontekstis)
Devictimizing Yourself 115 Monkey Me, Monkey Do 117 Monkey Die 120 Monkey Island 128 Defense 131 Sabotage 132 Looking Up 135 Summary 138 Study Questions 139 CHAPTER 5 Liking: The Friendly Thief 141 Making Friends to Influence People 144 Why Do I Like You? Let Me List the Reasons 146 Physical Attractiveness 146 Similarity 148 Compliments 149 Contact and Cooperation 151 Off to Camp 154" Back to School 156 Conditioning and Association 159 Does the Name Pavlov Ring a Bell? 163 From the News and Weather to the Sports 166 CONTENTS _ Defense 170 Summary 172 Study Questions 172
as compounding,derivation, coining, borrowing, etc. [2] Syntax: studies how words group together to make phrases and sentences. Sentences are not simply random strings of words; they conform to specific patterns determined by the syntactic rules of the language. The syntactic rules in a grammar must account for the grammaticality of sentences, word order, structural ambiguity, the meaning relations between words in a sentence, the similarity of meaning of sentences with different structures, the speaker's creative ability to produce and understand any of an infinite set of possible sentences. Notes: Proto-Germanic » Northwest Germanic » West Germanic » North Sea Germanic » Anglo Frisian » English 2. How to classify words into different word classes? (definition is that enough?, morphology, distribution and function tests); Grammatical categories for nominals, verbs, adjectives.
ted by philosophers, and it raises two main questions: What is "metaphorical meaning"? And how do hearers grasp metaphorical meaning as readily as they do? Most theorists have thought that metaphor is somehow a matter of bringing out similarities between things or states of affairs. Donald Davidson argues that this "bringing out" is purely causal, and in no way linguistic; hearing the metaphor just somehow has the effect of making us see a similarity. The Naive Simile Theory goes to the opposite extreme, having it that metaphors simply abbreviate explicit literal comparisons. Both views are easily seen to be inadequate. According to the Figurative Simile Theory, on the other hand, metaphors are short for similes themselves taken figuratively. This view avoids the three most obvious objections to the Naive Simile Theory, but not all the tough ones. Searle treats metaphorical meaning as speaker-meaning that is also con-
He clasps the crag with crooked hands... In the following example the initial ,,f" is particularly appropriate to the image of the blowing wind: The fair breeze blew, the white foam flew, The furrow followed free ... (S.T. Coleridge) The above example shows that alliteration may become onomatopoetic in quality. Consider also the following instance: Welling water's winsome word, Wind in warm wan weather .. (S.T.Coleridge) Another function of alliteration lies in connecting words by similarity of sound so that you are made to think of their possible connections: Good-bye, to Flattery's fawning face; To Grandeur with his wise grimace ..(Emerson) There have been attempts to define the expressive value of separate sounds. It has been noted, for instance, that the sounds l, m, n suggest slowness and peacefulness. An exhaustive study of consonants and some consonant clusters has been conducted by Marjorie Boulton who claims the following:
very alive and very much kicking. It is, therefore, necessary to look both at the concept itself and at the reasons for its success. Basic Problems of the New Public Management As important and, though more rarely, as successful as several NPM-inspired reforms of the public sector might have been and still may be, what one notices first when looking at the public and private spheres is the difference, not the similarity. The state is denoted primarily by its monopoly of power, force, and coercion on one side and its orientation towards the public good, the commonweal or the ben commune, on the other; the business world legitimately focuses on profit maximization. NPM, however, as it has been said, "harvests" the public; it sees no difference between public and private interest. The use of business techniques within the public sphere thus confuses the most basic requirements of any state,
interviews. In addition, some surveys are quite simple and inexpensive to do, such as a mail survey of members of a small professional association. Others are incredibly complex, such as a survey of the general public across all countries of the European Union in which the same questions need to be answered in multiple languages by people of all educational levels. In the mid-twentieth century there was a remarkable similarity of survey procedures and methods. Most surveys of significance were done by face-toface interviews in most countries in the world. Self-administered paper surveys, usually done by mail, were the only alternative. Yet, by the 1980s the telephone had replaced face-to-face interviews as the dominate survey mode in the United States, and in the next decade telephone surveys became the major data collection method in many countries
reasoning). - Existential universals - kognitiivne vahend, mis on kõikides kultuurides, aga ei kasutata sama probleemi lahendamiseks ega ole kõikidele kultuuridele samavõrra kättesaadav (intrinsic motivation). - Functional universals - kognitiivne vahend, mis on kõikides kultuurides, kasutatakse sama probleemi lahendamiseks aga ei ole kõikidele kultuuridele samavõrra kättesaadav (costly punishment, attraction to similarity, role of negative affect in depression). - Accessibility universals – kognitiivne vahend, mis on kõikides kultuurides, kasutatakse sama probleemi lahendamiseks ja kõikidele kultuuridele samavõrra kättesaadav (social facilitation, folk understanding of the laws of physics). WEIRD valim – Western, Educated, Industrialized, Rich, Democratic – ühiskonnad (kallutatus). Veel kallutatust: psühholoogiatudengid.
Too little oxygen results in carbon monoxide. Due to the high temperatures and high pressures involved, exhaust gases from petrol combustion in car engines usually include nitrogen oxides which are responsible for creation of photochemical smog. Formation Structure of a vanadium porphyrin compound (left) extracted from petroleum by Alfred E. Treibs, father of organic geochemistry. Treibs noted the close structural similarity of this molecule and chlorophyll a (right). Petroleum is a fossil fuel derived from ancient fossilized organic materials, such as zooplankton and algae. Vast quantities of these remains settled to sea or lake bottoms, mixing with sediments and being buried under anoxic conditions. As further layers settled to the sea or lake bed, intense heat and pressure built up in the lower regions. This process caused the organic matter to change, first into a waxy material known as
Huntington: tsivilisatsiooniline vaade 7-9 tsivilisatsioonilist rühmitust. Pinged nende vahel. Areng = võistlus ja konkurents The definition, nomenclature, and even the number of civilizations are somewhat ambiguous in Huntington's works. Civilizations may consist of states and social groups (such as ethnic and religious minorities). Predominant religion seems to be the main criterion of his classification, but in some cases geographical proximity and linguistic similarity are important as well. Using various studies of history, Huntington divided the world into the "major" civilizations in his thesis as such: Western civilization, centered on Western Europe (particularly the European Union) and North America, but also including other European-derived countries such as Australia and New Zealand. Huntington also includes the Pacific Islands, East Timor, Suriname, French Guiana, and northern and central Philippines.
//The form of the law was a kind of an enlightened doctrinal opinion. It is not a long jump from this conception to the view that the form of the law is expressed by legal concepts and that it is those notions that in a way carry the law from one phase of the development of society to the other. By their means one can in an exact way, as well as exhaustively, present the entire spectrum of cases covered by legal rules.// One finds here a similarity to those German thoughts of 18th century, introduced by Carl Friedrich von Savigny, which emphasized law being a manifestation of common legal ideology.] Immanuel Kant (1724-1804) Kant on kriitilise filosoofia rajaja (analüütilise filosoofia metoodika on kriitiline; ka analüütiline epistemoloogia algab kahest kriitilisest küsimusest: mida see tähendab? ja kust me seda teame? Tuleta meelde nt Popperi kriitiline ratsionalism). Sündis sadulsepa peres
Niisugust keele korrastatust nimetatakse süntagmaatiliseks. Igasugune keeletekst on korrastatud paradigmaatilist ja süntagmaatilist telge pidi. Roman Jakobson (1896-1982) Jakobsoni algseks uurimusalaks on, nagu Praha ringile kohane, eelkõige foneetika. Fonoloogia arenemine ajas. Jakobson toob ära kaks aspekti: Tähistaja ja tähistatava seost nimetab ta külgnevuseks (contiguity) ning see baseerub välisel faktoril. Seos sarnasuse (similarity) põhjal on tingitud keele sisemisest faktorist. Nendest lähtuvalt võib igas keelelises märgis välja tuua kaks operatsiooni liiki : Kombineerimine -- Iga märk koosneb osamärkidest ja/või esineb ainult ühenduses teiste märkidega. St, et iga lingv. ühik on üheaegselt kontekstiks lihtsamatele ühikutele (helidele, mis sõna moodustavad) ning/või leiab oma konteksti keerukamas lingv. ühikus (sõna lause kontekstis).
SHAW'S TERMINOLOGY Modern feline geneticists use b/b for chocolate, but Shaw defined chocolate as d/d, because to him it was a dilution of black. Reading Shaw's work on black, chocolate and Barrington Brown without knowing his terminology is therefore confusing. In Shaw's defence, the standard gene symbols had not been defined in the 1950s and 1960s. Light tan/cafe-au-lait in Shaw's terminology is d/d, b/b. To a modern reader, d/d, b/b indicates lilac. This, as much as any visual similarity, helps explain why his Barrington Brown is so often confused with the dilute modifier. Shaw’s Chocolate alleles D+- = Normal colour (black/sepia) d/d = chocolate (in Shaw’ s words, Chocolate Dilution) Shaw’s Maltese alleles M+ = Dense colours e.g. black m/m = Maltese (or in our terms dilution) e.g. blue is the maltese of black Shaw's Barrington Brown allele B+ = Normal coat b/b = Barrington Brown
rix ja Marco Marelli 2011. An amorphous model for morphological processing in visual comprehension based on naive discriminative learning. Psychological review, 118 (3), 438–481. Mona Baker 1993. Corpus Linguistics and Translation Studies: Implications and Applications. – Mona Baker, Gill Francis ja Elena Tognini-Bonelli (toim.), Text and Technology: In Honour of John Sinclair. Amsterdam: John Benjamins. Mona Baker 2004. A corpus-based view of similarity and difference in translation. International Journal of Corpus Linguistics, 9 (2), 167–193. Susan Bassnett 2006. Writing and translating. – Susan Bassnett ja Peter Bush (toim.), The Translator as Writer. London: Continuum, 173–183. Anthea Bell 2006. Translation: walking the tightrope of illusion. – Susan Bassnett ja Peter Bush (toim.), The Translator as Writer. London: Continuum, 58–67. Roger T. Bell 1991. Translation and Translating. London: Longman.
" "Do you talk by rule, then, while you are dancing?" "Sometimes. One must speak a little, you know. It would look odd to be entirely silent for half an hour together; and yet for the advantage of some, conversation ought to be so arranged, as that they may have the trouble of saying as little as possible." "Are you consulting your own feelings in the present case, or do you imagine that you are gratifying mine?" "Both," replied Elizabeth archly; "for I have always seen a great similarity in the turn of our minds. We are each of an unsocial, taciturn disposition, unwilling to speak, unless we expect to say something that will amaze the whole room, and be handed down to posterity with all the eclat of a proverb." "This is no very striking resemblance of your own character, I am sure," said he. "How near it may be to mine, I cannot pretend to say. You think it a faithful portrait undoubtedly." "I must not decide on my own performance."
18. THE HUNT 19. GOODBYES 20. IMPATIENCE 21. PHONE CALL 22. HIDE-AND-SEEK 23. THE ANGEL 24. AN IMPASSE EPILOGUE: AN OCCASION twilight STEPHENIE MEYER LITTLE, BROWN AND COMPANY New York Boston Text copyright © 2005 by Stephenie Meyer All rights reserved. Little, Brown and Company Time Warner Book Group 1271 Avenue of the Americas, New York, NY 10020 Visit our Web site at www.lb-teens.com First Edition: September 2005 The characters and events portrayed in this book are fictitious. Any similarity to real persons, living or dead, is coincidental and not intended by the author. Library of Congress Cataloging-in-Publication Data Meyer, Stephanie, 1973-- Twilight : a novel / by Stephanie Meyer. -- 1st ed. p. cm. Summary: When seventeen-year-old Bella leaves Phoenix to live with her father in Forks, Washington, she meets an exquisitely handsome boy at school for whom she feels an overwhelming attraction and who she comes to realize is not wholly human. ISBN 0-316-16017-2 [1
section: the secondary text oritur would become the tertiary text or-ri-it-tu- ur. Any of these groups that contained any of the letters of the word conmuta, plus q, underwent a special substitution. The resultant quaternary text was then "translated": Newbold replaced the pairs of letters with a single letter, presumably according to a key, which, however, he never made clear. Newbold regarded some letters of this reduced quinary text as equivalent to one another because of phonetic similarity. When required, therefore, he interchanged d and t, for example, b, f, and p, o, and u, and so on. Finally, Newbold anagrammed the letters of this senary text to produce his Latin plaintext. In April, 1921, Newbold announced the preliminary results of his solution according to this method before brilliant and learned audiences. These results stamped Roger Bacon as the greatest scientific discoverer of all time. According to Newbold, Bacon had recognized the Great
Suggested AnswerKey -ext A ' TheWhiteCliffsof Doverarewhitebecause theyaremade of chalk. ihe White Cliffsof Dover make the Englishcoastline . Elicit useful languageto expresscontrast (whereos, nemorable. however, but,on theotherhand,etc); similarity(also,the ,,4any shipwrecks canbefoundbelowthecliffs. same,furthermorc, etc) EncourageSs to use these Thestrotegiclocotionof theWhiteCIiffsof Doverhelpedto phraseVlinkers in theirdialogues. protectEnglandfrom itsinvaders. TheEnglishChannelis oneof the world'sbusiestshipping Suggested AnswerKey lones
annaabi.ee 
