European yew Ursula 11. kl Description It is a small- to medium-sized evergreen tree, growing 1020 metres. The bark is thin, brown, coming off in small flakes aligned with the stem. The leaves are lanceolate, flat, dark green and highly poisonous. The seed cones are highly modified, each cone containing a single seed long partly surrounded by a modified scale which develops into a soft, bright red berry-like structure called an aril. The arils are mature 69 months after pollination, and with the seed contained are eaten by thrushes, waxwings and other birds. The aril is not poisonous....
140 200 workers would pull the stone upright perhaps using a pulley. The hole was filled with rocks and boulders packed tightly together. Mortise, tenons, and toggle joints were used to hold the lintels and sarsens together. Why?? Theories-why was it built? Predict astronomical events. 30 sarsens in the circle could symbolize the days of the month 19 bluestones in the horseshoe could be the 19 year cycle of the moon Aligned with the midsummer sunrise and midwinter sunset Sacred site Who built it?? Merlin, the magician in King Arthur's time moved the stones to honor soldiers Built by Roman invaders Druids No one really knows the answer. Vandalism through the ages Romans ruined part of it when they were destroying pagan sites Stones were removed for bridges, houses, other building Continual touching has altered the faces of the stone Visitors chiseled away samples for souvenirs...
Carl Robert Jakobsoni Nimeline Gümnaasium Indoneesia Uurimustöö Siim Teder 10c Juhendaja: Hilje Nurmsalu Viljandi 2008 Sisukord Lk2 ..................................................Sisukord Lk3 ..................................................Sissejuhatus/Üldandmed Lk4 ..................................................Geograafiline asend Lk5 ..................................................Looduslikud tingimused Lk6 ..................................................Riigi arengutase Lk7 ..................................................Rahvastik Lk8 ..................................................Energiamajandus Lk9 ..................................................Põllumajandus Lk10 ................................................Transport...
It is one of the most famous prehistoric sites in the world and is composed of earthworks surrounding a circular setting of large standing stones. The surrounding circular, earth bank and ditch, have been dated to about 3100 BC. Stonehenge was produced by a culture with no written language. Many aspects of Stonehenge remain subject to debate. There is little or no direct evidence for the construction techniques used by the Stonehenge builders. *The Celts in Britain and their legacy The Cets lived in Britain in The Iron Age. They were warring tribes who were battleful amongst themselves as well as inter-tribal war. They were not centrally governed. The Celts brought iron working, iron ploughs and metal swords, horses, wheels and chariots - all these things gave them an instant superiority over the native tribes. The Celts built a number...
1·1 Chapter 1 Routine maintenance and servicing 1 Contents Air cleaner element renewal . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .34 Fuel filter renewal - fuel injection engines . . . . . . . . . . . . . . . . . . . .36 Alternator drivebelt check . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .20 Hinge and lock check and lubrication . . . . . . . . . . . . . . . . . . . . . . .31 Automatic transmission fluid level check . . . . . . . . . . . . . . . . . . . . .27...
Eesti Põllumajandusülikool Tehnikateaduskond Mehaanika ja masinaõpetuse instituut Enno Saks Joonestuspakett AutoCAD 2000 (versioon 15.0) I Kahemõõtmeline raalprojekteerimine Tartu 2000 Käesolev kaheosaline lühijuhend käsitleb tarkvarafirma Autodesk tuntuimat produkti joonestuspaketti AutoCAD 2000. Tegemist on ühe levinuima universaalse joonestuspaketiga kogu maailmas. Võrreldes sama paketi eelmise versiooniga (14.0) on käesolevasse versiooni (15.0) sisse viidud suurel hulgal muudatusi ja täiendusi, arvult üle 400. Nii ulatuslikku uuenduskuuri ei ole paketi varasemate versioonide puhul läbi viidud. Muuseas on muutunud peaaegu kogu dialoog arvutiga, millega joonestusprotsess arvatavasti muutub tarbijasõbrali- kumaks. Märgime siinkohal, et paketi nimetus AutoCAD on lühend sõnadest Automated Computer Aided Drafting...
Eesti Põllumajandusülikool Tehnikateaduskond Mehaanika ja masinaõpetuse instituut Enno Saks Joonestuspakett AutoCAD 2000 (versioon 15.0) II Kolmemõõtmeline raalprojekteerimine & Programmeeritud joonestamine Tartu 2000 1. Ruumilised koordinaadid Ruumiliste jooniste valmistamiseks on vajalik tunda tähtsamaid ruumilisi koordinaatsüs- teeme (vt joonis 1): ristkoordinaate xyz, silinderkoordinaate rz ja sfäärkoordinaate . Silinderkoordinaatide saamiseks tuleb punkt P(x,y,z) projekteerida XY-tasandile, selleks on joonisel 1 punkt P'(x,y,0). Punkti P' kaugus koordinaatide algusest O ongi parajasti polaar- raadius r (r = x 2 + y 2 ), polaarnurk (0O < 360O , või ka 180O < 180O ) on aga nurk X-telje positiivse suuna ja polaarraadiuse vahel, kusjuures x = rcos , y = rsin . Koordinaadid...
Bedroom, living room, study room Fully furnished what furniture? 90 pounds per week any extras to pay like electricity? Ideal for student 36 Stewart Street does it have a phone? available how soon? London N4 2PP 0181 809 7985 A letter starts with a date, except when it is said that the date is not necessary. Usually on national examination, the date is already written on the writing paper. Date must be written on the first line of the task and aligned right. Possible ways of writing: May 8, 2010 8 May 2010 Any other ways of writing a date is not advised because if you do so, you may lose points in an extremely easy part of a writing task. On the next line of the letter it is important to start the letter with ,,Dear". In case you didn't get information from the task about the persons name you are writing to, you have to use ,,Dear Sir/Madam" or ,,Dear Sir or Madam"...
On November 4, 1980 Marley was baptized by the Archbishop of the Ethiopian Orthodox Church in Kingston, Jamaica. Here is what Archbishop Abuna Yesehaq had to say on Marley: "Bob was really a good brother, a child of God, regardless of how people looked at him. He had a desire to be baptised long ago, but there were people close to him who controlled him and who were aligned to a different aspect of Rastafari . But he came to Church regularly. I remember once while I was conducting the Mass, I looked at Bob and tears were streaming down his face...When he toured Los Angeles and New York and England, he preached the Orthodox faith, and many members in those cities came to the Church because of Bob. Many people think he was baptised because he knew he was dying, but that is not so...he did it when...
Chapter Eighteen Instruction As Alice's graduation party ends, Bella is anxious that Jacob's pack has aligned themselves with the Cullens against the newborns. Everyone reassures Bella there is no danger but she remains worried, agonizing over why her bad luck continually puts other people in harm's way. The wolves and the vampires intend to meet for a training session at 3:00 AM. Bella tells Edward she wants to accompany him. Edward notes that she is tired and says he doesn't want her present for any tensions between the two groups if the training experiment does not go well, but she insists...
PRODUCT ERGONOMIC KEBOARD A "fixed-split keyboard" is a single board, with the keys separated into two or three groups, allowing the user to type at a different angle than the typical straight keyboard. An "adjustable split keyboard" has the keyboard split into several independent pieces, so the angle between them can be easily changed. Either of these types of keyboards may include elevated sections at various angles. Other ergonomic keyboards have fixed, vertically aligned keys, so the user types with their hands perpendicular to the ground, thumbs-up. Still others allow a range of rotation and elevations. Simple ergonomic keyboards can cost as little as typical keyboards or as much as $995 for high end keyboards. An ergonomic keyboard may reduce muscle strain and reduce risk of Carpal Tunnel syndrome, but there is no clear evidence of benefit. After a user takes the time to adjust to this style of...
Its first monarch was Henry Tudor, a 4 descendant through his father, although ultimately not male line, of the rulers of the Welsh Kingdom of Deheubarth. Through his mother he descended from a legitimised branch of the English royal House of Lancaster. The Tudor family rose to power in the wake of the Wars of the Roses, which left the House of Lancaster, to which the Tudors were aligned , extirpated. 18. Henry VII - was King of England and Lord of Ireland from his seizing the crown on 22 August 1485 until his death on 21 April 1509, as the first monarch of the House of Tudor. Henry won the throne when he defeated Richard III at the Battle of Bosworth Field. He was the last king of England to win his throne on the field of battle. He was successful in restoring the power and stability of the English monarchy after the political upheavals of the Wars of the Roses. He founded a...
From that database, LSA would determine the likelihood of encountering certain words (e.g.., the term "conscience" as a synonym for "superego") given the constellation of vocabulary in the reference text. A candidate essay with more relevant vocabulary will be awarded a higher score. In setting up the models, IEA incorporates a validation procedure to check that LSA scores are aligned with those that might be given by human raters. In contrast to e-rater and Intellimetric, the non-content features (e.g., mechanics, style, organization) of IEA are not fixed, but rather are constructed as a function of the domains assessed in the rating rubric. The weights for prox variables associated with these domains are predicted based on human ratings, and then are combined with the score calculated for content....
Ergo Pikas Integration of Lean Construction and Building Information Modelling DISSERTATION Tallinn 2010 2 UNIVERSITY OF APPLIED SCIENCES Author: Ergo Pikas- Civil Engineering student, Faculty of Construction, Tallinn University of Applied Sciences Supervisor: Rafael Sacks- Associate Professor, Faculty of Civil and Env. Engineering, Technion Israel Institute of Technology Consultant: Roode Liias- Professor and Dean, Faculty of Civil Engineering, Tallinn University of Technology Title: Integration of Lean Construction and Building Information Modelling Archived: University of Applied Sciences, Faculty of Construction ABSTRACT This research can be divided into two. The first part investigates the current state of the construction industry,...
Discussions driving integrated coordinated outcomes for patients led to the establishment care have been characterised by "Mrs Smith", a fictitious of a care trust in 2005. The development of five integrated 85-year-old with a range of care needs and requiring health and social care teams aligned to general practice, coordinated support across health and social care. single assessment processes, and shared health and Mrs Smith has come to represent vulnerable local social care electronic records are processes that have residents at risk of falling between gaps in the service. facilitated integration. The focus is on improving clinical, By focusing on Mrs Smith, care has been reorganised satisfaction and efficiency outcomes (Leutz, 1999)....
Eesti Ettevõtluskõrgkool Mainor TEKSTIDOKUMENDI LOOMINE WORD 2010 (2007) ABIL Infotöötluse loengukonspekt Kalev Avi, MSc Tartu 2011 SISUKORD Kiirklahvid .....................................................................................................................................................3 Funktsionaalklahvid .......................................................................................................................................5 Sissejuhatus ....................................................................................................................................................6 Wordi dokumendi struktuur ...........................................................................................................................7 MS Wordi ekraanipilt...
Unitary Matrix Also known as Identity Matrix. A scoring system in which only identical characters receive a positive score. Tühiku skoorid- Calculating alignment scores. The raw score S for an alignment is calculated by summing the scores for each aligned position and the scores for gaps. In this figure, a DNA alignment is shown. In amino acid alignments, the score for an identity or a substitution is given by the specified substitution matrix (e.g. BLOSUM62). BLAST 2.0 and PSI-BLAST use "affine gap costs" which charge the score -a for the existence of a gap, and the score -b for each residue in the gap. A gap of k residues therefore receives a total score of -(a+bk) and a gap of length 1...
1. Milliste ülesannete lahendamisel on vajalik järjestuste joondamine? 2. Kasutada suvalist dot ploti visualiseerimise programmi (näiteks DotMatcher http://mfgn.usm.edu/cgi-bin/emboss.pl?_action=input&_app=dotmatcher või DotPlot'i applet http://arbl.cvmbs.colostate.edu/molkit/dnadot/index.html). Leida järgnevate nukleotiidsete järjestuste paaride sarnased piirkonnad erinevatel raami suurustel ja sarnasuse piirväärtustel raam = 1, lim = 0. Leida kõik suuremad sarnased piirkonnad varieerides raami ja piirväärtuse suurust, põhjendada tulemuste seost parameetrite väärtustega. Millise nähtusega võiks tegemist olla? · atgttgatgattaaaggaattatttttgatatggacggtgttttatttgatacagaacctttttatctgaggcg acgagaagatttttttaagacaaagggaattcccatt...
Does our mission need to be redefined? Are our strategic goals aligned with our mission? Who are our customers? ,,Often, no one is responsible for the overall performance of the entire process." ,,Reengineering maintains that optimizing the performance of subprocesses can result in some benefits, but cannot yield dramatic improvements if the process itself is fundamentally inefficient and outmoded." ,,For that reason, reengineering focuses on redesigning the process as a whole in order to...
Sylvia Day Bared to You Sylvia Day Bared to You The first book in the Crossfire series, 2012 This one is for Dr. David Allen Goodwin. My love and gratitude are boundless. Thank you, Dave. You saved my life. Acknowledgments My deepest gratitude to my editor, Hilary Sares, who really dug into this story and made me work for it. Basically, she kicked my ass. By not pulling her punches or letting me shortchange the details, she made me work harder and because of that, this story is a much, much better book. BARED TO YOU wouldn't be what it is without you, Hilary. Thank you so much! To Martha Trachtenberg, copy editor extraordinaire. This book is an important one for me and she treated it that way. Thank you, Martha! T...