Identity theft What identity theft means? It is a serious crime. Is it possible that somebody's identity can be stolen? It's not possible. Is the owner of an ID responsible, if somebody uses it? Yes. Types financial identity theft (using another's identity to obtain goods and services) criminal identity theft (posing as another when apprehended for a crime) identity cloning (using another's information to assume his or her identity in daily life) business/commercial identity theft (using another's business name to obtain credit) Identity theft may be used to facilitate crimes including illegal immigration, terrorism, and espionage. What are the techniques for obtaining personal information? Legal response Australia Imprisonment for 5 years. France five years in prison and fined up to 75,000.
Youth. Identity Young, The Art of Youth Work. by: Kerry Yong Pille-Riin Pruus Autorist • Kerry Yong • 1977 seotud • Probleemide olemus Meetodika • Põhineb intervjuude kogumisest • 32 üksikisikut • 3 peamist põhjust Filosoofia • Olemuse mõistmine • Noorsootöö identiteet • Edukas Noorsootöötaja • Põhilised väljakutsed Identiteet • Olemus • Tähtsus • Mõjutavus Töö noortega • Noor hakkab teadvustama iseennast ning teisi! Kolb learning cycle 1984 Kasutatud kirjandus • https://moodle.hitsa.ee/pluginfile.p hp/756593/mod_resource/content/0/The artoftheyouthwork.pdf TÄNAN KUULAMAST!
Identity as a personal project How could be one identity created? Or is it creating itself? Or, maybe, every child is born with some kind of identity? There are many theories about what identity is and how it is developing, so in this essay I want to discuss A. Giddens´ text and my reflection about his theory. “It's like everyone tells a story about themselves inside their own head. Always. All the time. That story makes you what you are. We build ourselves out of that story.” Patrick Rothfuss When talking about identity, it´s creation is a very important moment. To
Majandussotsioloogia Seminar 2 Tekst 1 Jekaterina Bavõkina 193893TABB Tekst 1: Eesti Inimarengu Aruanne (EIA) 2016/2017, Põhisõnumid. Eesti rändeajastul. Tiit Tammaru, Kristina Kallas, Raul Eamets. Kättesaadav: https://inimareng.ee/pohisonumid-eesti-randeajastul/ - Mida tähendab mõiste „hargmaisus“? Kuidas väljendub hargmaisus tänapäevases Eestis? Milliseid probleeme ja ka uusi võimalusi see ühiskonnale endaga kaasa toob? Hargmaisus on inimeste ja ettevõtete ränne, nimelt nende tegevus mitmes riigis. Rändel on üks tunnusjoon: see on tõmme heaolu poole. Inimesed rändavad küll erinevatel põhjustel, olgu see töötamine, perega seotud tegurid, õppimine või põge- nemine tagakiusamise eest, kuid minnakse riikidesse, kus elu on parem. Eesti on pagulast...
Aim Determining the identity of an unknown metal. Measurement of gas volume, calculations with gases based on reaction equations. Substances 10% solution of hydrochloric acid, 5,0...10,0 mg piece of a metal. Equipment Apparatus for measuring the volume of gas, measuring cylinder (25 cm 3), funnel, filter paper, thermometer, barometer and hygrometer. Experimental procedure 1. The experimental apparatus (Figure 1) consists of two burettes connected with a rubber hose (a), which is filled with water. One burette is connected to a test tube (b), in which the metal reacts with the acid. 2. Preparation for the experiment. Remove the test tube and wash it carefully with distilled water. Firmly attach the test tube back. Adjust the burettes to the same height and check whether the water level (c) in both of the burettes is at the ...
Anthony Kaldellis, Hellenism in Byzantium. The transformation of Greek identity and the reception of the classical tradition. Cambridge: Cambridge University Press, 2007. Lugemismaterjali antiigipärandi 1. loengu juurde: lk 173187 (pdf-fail olemas ÕISis, kodutoo1_Kaldellis_tekst.pdf) Küsimused: 1) Kuidas suhestusid katkendis kirjeldatud perioodil kristlus ja antiik üksikute autorite kontekstis? Too näiteid.
Pille-Riin Pruus Youth. Identity Young, K. (1999) The Art of Youth Work. Russell House Publishing Autorist Kerry Yong on seotud Noorsootööga aastal 1977 kui eraldi Noorsootöötaja ja hiljem Riiklik Noorsootöö Büroos,Riiklik Assotatsioon ja Noorte klubi( nüüd Noorte Klubi UK) ja Riiklik Noorsootöötaja Agent. Nüüd on ta sõltumatu konsultant ja partner Noorsöötöö asjade üksuse De Monforti Ülikooli,Leicester.
Identity theft The Estonian Information Technology College Social, Professional and Ethical Aspects of Information Technology 18.10.2016 The purpose of this paper is to raise awareness about the threats associated with Identity theft. I will talk about the different types of identity theft, the most common way they take place and what consequences they might have. I will also talk about some of the examples and point out actions everyone can take to minimize the chance of becoming a victim of an identity theft. What is Identity theft Identity theft is defined as the deliberate use of someone else's identity, usually as a method to gain a financial advantage or obtain credit and other benefits in the other person's name, and
framing concept and conceptualises individuals who style their lives around the enduring practice of backpacking as ‘lifestyle travellers’. Ethnographic interviews with lifestyle travellers in India and Thailand offer an emic account of the practices, ideologies and social identity that characterise lifestyle travel as a distinctive subtype within backpacking. Departing from the drifter construct, which (re)constitutes this identity as socially deviant, the concept of lifestyle allows for a contemporary appraisal of these individuals’ patterns of meaningful consumption and wider insights into how ongoing mobility can lead to different ways of understanding identities and relating to place. Keywords: lifestyle consumption; backpacker; mobility; drifter; identity INTRODUCTION Within the social world of backpacking, there exist a small proportion of tourists who travel as a lifestyle for years on end
# Program: needle # Rundate: Wed Mar 07 18:02:24 2007 # Align_format: srspair # Report_file: /ebi/extserv/old-work/needle-20070307-18022349260605.output ######################################## #======================================= # # Aligned_sequences: 2 # 1: EMBOSS_001 # 2: EMBOSS_001 # Matrix: EDNAFULL # Gap_penalty: 10.0 # Extend_penalty: 0.5 # # Length: 909 # Identity: 405/909 (44.6%) # Similarity: 405/909 (44.6%) # Gaps: 504/909 (55.4%) # Score: 2025.0 # # #======================================= EMBOSS_001 1 atgttgatgattaaaggaattatttttgatatggacggtgttttatttga 50 EMBOSS_001 1 0 EMBOSS_001 51 tacagaacctttttatctgaggcgacgagaagatttttttaagacaaagg 100 EMBOSS_001 1 0
IS PEER PRESSURE MORE USEFUL THAN HARMFUL? Peer pressure is a feeling that one must do the same things as other people of one's age and social group in order to be liked or respected by them. One good side of peer pressure is that it will definitely help people to learn haow to handle complex situations. Peer pressure is useful when helps you to advance. It can help you bring a positive change in the way you think. Good peer pressure is basically motivation. On the ohter hand, peer pressure often makes people feel like they need to change who they are to belong in group. It forces people to lose their own identity. It will also likely result in having many bad habits during your teenage years, which are difficult to change when you get older, like drinking and smoking. Peer pressure has both good and bad sides. If you can use peer pressure to develope your character while being able to maintain yourself it is very useful. But you must n...
TÄISKÄSVÄNU KUI Triin Lepp ENESEÄRENGU SUBJEKT Sõnastik L. Kaade uurimustöö põhjal Subjekt SUBJEKTIKS OLEMINE= Subjektile omane teadlik MÕTESTTUD aktiivsus ilmneb SUBJEKT-teadvustatud AKTIIVNE suhtlemise ja selle aktiivsuse TEGUTSEMINE osapoolte kandja, kes on suuteline vastastikuse mõjutamise orienteeruma, otsustama, kaudu ning avaldub töö, tegema seda, mida ta on loomingu ja probleemide kavatsenud teha, ning lahendamise läbi vajadusel ka oma tegevust Aktiivsus on subjektsu...
Deposit slip (panga) sissemakse kviitung Performance (töö) sooritus Punctuality ajaline täpsus Initial algne To set up asutama firmat Stockbroker börsimaakler Life savings elusäästud Embezzle ettevõtte raha omastama Reckless hooletu Identity theft identiteedi vargus Escapade julgustükk Profit kasum Take sb hostage kedagi pantvangi võtma Impersonate sb kehastama kedagi Assume a false identity kellegi identiteeti omastama Perpetrate kuritegu sooritama Handful käputäis Expand laiendama Paediatrician lastearst Eventually lõpuks, lõplikult Amass midagi palju koguma Defraud, swindle out petma rahaliselt Con artist pettur Scam petuskeem Raise money raha koguma Blow money on sth raha loopima Legitimate seaduslik Reject tagasi lükkama Root for toetama Confidence trick usalduse petmine, kuritarvitamine
Lisaks kasutatakse seda veel selleks, et vältida lambda avaldiste kirjutamist. test :: Maybe Bool test = do x <- Just 9 Just (x > 8) x <- Just 9 tähendab seda, et muutujale x väärtustatkse monadic value. Just (x > 8) tähendab seda, et kasutatakse Maybe monad-ist esimest funktsiooni. 12.5 The list monad instance Monad [] where return x = [x] xs >>= f = concat (map f xs) fail _ = [] 12.6 Monad laws 12.6.1 Left identity Kui võtta väärtus ja panna see context-i return funktsiooniga ja siis kasutada >>= funktsiooni on sama kui võtta väärtus ja rakendada selle peal mingit tingimust. return x >>= f on sama f x. Näide: return 3 >>= (x -> Just (x+100000)) on sama kui (x -> Just (x+100000)) 3. 12.6.2 Right identity Kui on monadic value ja kasutame >>= ja return funktsioone on sama kui kasutada ainult monadic value-t. m >>= return on sama m. Näide:
Problem 1 In April 2011, Sony experienced a data breach within their PlayStation Network. It is estimated that the information of 77 million users was compromised. Sources "based on information currently available to Sony, our currently known costs associated with the unauthorized network access are estimated to be approximately 14 billion yen," or about $171 million. http://www.informationweek.com/security/attacks/sony-data-breach-cleanup-to-cost-171-mil/229625379 The attacker said he exploited the Greek Sony website using a SQL injection attack against the site, which was running Internet Information Server (IIS) 6.0 on Windows 2003. SQL injection attacks, which exploit website databases that haven't been patched against known vulnerabilities, are much favored by attackers, in part for their simplicity. http://www.informationweek.com/security/attacks/sony-data-breach-cleanup-to-cost-171-mil/229625379 The details of the users of t...
TV violence Nowadays, television is the mainstream medium, which influences significantly the public opinion and, furthermore, it has the power to influence the formation of an individual’s identity. In such a situation, television violence has a particularly significant and dangerous impact on the viewers, especially youth, whose identity, moral values and beliefs are in the process of formation. Young people often perceive celebrities they see on TV and imaginary characters they see in movies as models for their own behavior. Children usually want to be soldiers or gangsters. As a result, they attempt to follow their lead, which often leads to the development of negative models of behavior. Also, some people think that fighting scenes, explosions, shooting scenes and other violent elements of movies are so awesome
some conversations and lots of quotes in Internet contain "J.D.Salinder" in the end of it, therefore I was really excited when we decided to read this book as a part of our English lesson course. It was very good way for English skills practice and also self- liberalizing. I think many teenagers would be able to relate the book to the actual themes - it's a modern classic of today. Every teeneager has had once felt himself sort of depressed and upset. It is absolutely normal state for identity formation. We mature, we become adults, we revise our values and are feeling really unusual sometimes. Lots of times I have caught myself thinking that I'd already felt something like this before... Lots of moments in this book were really similar to some periods of my life and many relatives seemed very similar to characters of this book. "The Catcher in the Rye" certainly wouldn't be everyone's "cup of tea book", however
Inimesed on hakanud rääkima juba eesti ja inglise keele segu, nii et vanem generatsioon peab tihtipeale kõrvu kikitama, et üldse aru saada, millest räägitakse. Meid mõjutavad välismaa filmid ja sarjad ja internet, milleta me enam oma elu ette ei kujutaks. See võib panna jällegi nii mõndagi inimest mõtlema, et teisel pool on ju muru palju rohelisem. Me tahame olla ju alati paremad kui teised ja seetõttu on ka eestlased palju läänelikku omastanud. Artiklis ,,Ideology, Identity, and Intercultural Communication: An Analysis of Differing Academic Conceptions of Cultural Identity" (2007) on samuti räägitud murest algupärase kultuuri identiteedi püsimise pärast. Young Yun Kim rõhutab, et kultuuridevahelise identiteedi arenemisega kaasnevad ka kaotused ning, et pikaaegne identiteedi evolutsioon assimilatsiooni suunas viib lõpuks oma algupärase identiteedi hülgamisele või sellest mööda vaatamisele.
No. Perekonna- ja eesnimi/ Family name, given Amet/ Rank Kodakondsus Sünniaeg ja koht/ Isiku tõendava name /Nationality Date and place of dokumendi No./ birth Identity dokument No. Kapteni või volitatud isiku allkiri, kuupäev. __________________________ ______/_____/____________ Date and signature by master, authorized agent or officer.
school at the age of 16. During his teen years he wrote numerous poems and had his first poem published in 1933. During his career Thomas also wrote short stories, essays, film scripts and one novel. His poems seem to be disorderly, overwhelming outpourings of language. In 1949 he began visiting the US for poetry reading tours, he became a celebrity there. His most famous play "Under Milk Wood". His favourite themes were London in wartime, nature, Wales's culture and identity. Most well known works: "Eighteen poems", "Do not go gentle into that good night", "Twenty-five Poems".
Postal(zip) code Linn Perekonnaliikmed: Eesnimi/ City Perekonnanimi/ Sünniaeg/ Kodakondsus Family members: Forenames/ Surname/ Date of birth/ Citizenship Riik Country Sünniaeg Date of birth E-mail aadress E-mail address Kodakondsus Citizenship Passi või ID kaardi nr Passport or identity card no Auto nr Car no Reisi eesmärk Äratus Aim of visit Wake up call Töö/ Work Jah /Ei Konverents/ Conference Yes/ No Puhkus/ Holiday Äratus järgnevateks päevadeks Üritus/ Event Next day wake up call
Romania in) Exit into History (1999) this paper aims to show that such translations, if undertaken, may turn into complex exercises of intercultural communication in our global world, confronted with problems of identity and representation. The first section analyses in detail the cultural translations of Romania that the two authors provide for their (Western) readers. Consequently, it brings to the fore intricate acts of mediation and cultural filtering that are part
tulevikus, toetudes mineviku kogemustele. Eesmärk: Kinnitada, või ümber lükata hüpotees. Samuti saada teadmisi rahvuskultuurilisest arengust läbi ajaloo. Kasutatud allikad Jansen, Ea. 12/6. Rahvuseks saamise raske tee. Akadeemia Kruus, Hans. 3/1939. Väikerahvalik tunnetus eesti ühiskondlikus mõttes. Ajalooline ajakiri Kuldna, V 1991. Eesti ajalugu. Programm TPÜ üliõpilastele. Tallinn Smith A.D. National Identity Vahtre, L 1993 Eesti kultuuri ajalugu. Lühiülevaade. Tallinn. Uurimistöö meetod 1. Kvantitatiivne ja osaliselt kvalitatiivne. 2. Küsitlust läbi ei viinud, kuid autor toetus kirjanduse uurimisele ja erinevate teemakohaste andmete läbitöötamisele. Tulemused Rahvakultuuri peamised funktsioonid. Uurimistöö tulemused Autor on nõus, et ärkamisajal aset leidnud sündmuste ja rahvuslikuliikumise eestvedajate koosmõju teataval määral
the world's best-known cryptozoological creature and has been sighted as far back as 656 AD. Nessie is described as being anywhere from twenty to forty feet long, with two humps, a tail and a snakelike head. Nessie's movements have been studied, and many films and photos analyzed, to determine what Nessie might be, if she exists. For the last seventy years or so, since she began receiving regular publicity, Nessie has been a major tourist attraction. There are numerous theories as to Nessie's identity, including a snake- like primitive whale known as a zeuglodon, a long-necked aquatic seal, giant eels, walruses, floating plants, giant molluscs, otters mirages and diving birds, but many lake monster, researchers seem to favour the plesiosaur theory. The case has occasionally been supported by indistinct photographic evidence, though a famous 1934 photograph was revealed to be a hoax.
acid i mutates into amino acid j for all pairs of amino acids. such matrices are constructed by assembling a large and diverse sample of verified pairwise alignments of amino acids. If the sample is large enough to be statistically significant, the resulting matrices should reflect the true probabilities of mutations occurring through a period of evolution. Unitary Matrix Also known as Identity Matrix. A scoring system in which only identical characters receive a positive score. Tühiku skoorid- Calculating alignment scores. The raw score S for an alignment is calculated by summing the scores for each aligned position and the scores for gaps. In this figure, a DNA alignment is shown. In amino acid alignments, the score for an identity or a substitution is given by the specified substitution matrix (e.g. BLOSUM62). BLAST 2
thee Bailiwicks of Jersey and Guernsey in the English Channel. Although internationally, the dependencies are recognised as "territories for which the United Kingdom is responsible", the relationship between the Crown dependencies and the UK is "one of mutual respect and support, i.e. a partnership". In 2007-2008, each Crown Dependency and the UK signed agreements that established frameworks for the development of the international identity of each Crown Dependency. 9. Devolution- the statutory granting of powers from the central government of a sovereign state to govern at a subnational level, such as a regional, local, or state level. It is a form of decentralization. Devolved territories have the power to make legislation relevant to the area. 10. Devolved powers- the Scottish Parliament and the Welsh and Northern Ireland Assemblies are devolved powers, subordinate to the UK Parliament. 11
Joel Sang Jelissei Zahharov 7.Klass Sillamäe Eesti Põhikool Joel Sang elu Joel on sündinud 15 mail 1950 pärnus.Ta on Eesti luuletaja kirjanduskriitik, keeleteadlane, tõlkija ja publitsist.Sang lõpetas 1968 Tallinna 21, keskkooli1974 TRÜ Eesti filoloogiat erialal ning 1980 TÜ-s aspirantuuri, kaitstes filoloogiakandidaadi kraadi väitekirjaga "Eitus eesti keeles".Ta töötas 1974-75 Tallinna 15 Õhtukeskkooli õpetajana. Looming Joel Sang on avaldanud keelealaseid artikleid, kirjandusarvustusi ja publitsistikat. Kirjanduslikku tegevust alustas Sang luuletajana nelja autori ühiskogus "Närvitrükk" (1971). Ta on kirjutanud laulutekste ja ooperilibretosid ning soome, inglise ja vene keelest. 1984. aastast kuulub Sang Eesti Kirjanike Liitu. Tunnustused 2011 Valgetähe IV klassi teenetemärk. Joel Sang on August Sanga ja Kersti Merilaasi poeg Luulekogud "Abisõnad" (1983) "Vigade parandus" (1988)...
Pros and cons of digital communication and face- to-face communication Richard-Sven Rivik Digital communication: pros • Convenient • Fast • Simple • Record of conversation • Hybrid meetings • Media content Digital communication: cons • Lying • Bad for your eyes • Fake identity • Overuse • Privacy Face-to-face communication: pros • Express of feelings • Instant response • Better knowledge • Collaborate • Suitable for discussions Face-to-face communication: cons • Schedule availability • Distance • Time consuming • Media content • Not effective in large gatherings THANKS FOR WATCHING AND LISTENING! References 1 • https://brm.institute/f2f-vs-digital-communication-pros-cons-use /
eesmärk: aktiivsus positiivne lahendus: eesmärk (purpose) eesmärgipärasus negatiivne lahendus: süü rituaal: imiteerimine riitus: mask (rollimängud) IV. 6.0 - 12.0 industry vs inferiority eesmärk: oskused positiivne lahendus: kompetentsus (competence) oskused negatiivne lahendus: alaväärsus rituaal: vilumused ülesannete lahendamiseks riitus: formaalne tegutsemine V. 12.0 - 18.0 indentity vs identity confusion eesmärk: identiteet positiivne lahendus: identiteet (identity) negatiivne identiteet usaldus (fidelity) psühhosotsiaalne moratoorium negatiivne lahendus: identiteedi puudumine rituaal: ideede süsteem ehk ideoloogia riitus: absoluutne tõde, totaalsus VI. 18.0-24.0 intimacy vs isolation eesmärk: lähisuhted positiivne lahendus: armastus (love) intiimsus negatiivne lahendus: üksildus rituaal: lähisuhted
eesmärk: aktiivsus positiivne lahendus: eesmärk (purpose) eesmärgipärasus negatiivne lahendus: süü rituaal: imiteerimine riitus: mask (rollimängud) IV. 6.0 - 12.0 industry vs inferiority eesmärk: oskused positiivne lahendus: kompetentsus (competence) oskused negatiivne lahendus: alaväärsus rituaal: vilumused ülesannete lahendamiseks riitus: formaalne tegutsemine V. 12.0 - 18.0 indentity vs identity confusion eesmärk: identiteet positiivne lahendus: identiteet (identity) negatiivne identiteet usaldus (fidelity) psühhosotsiaalne moratoorium negatiivne lahendus: identiteedi puudumine rituaal: ideede süsteem ehk ideoloogia riitus: absoluutne tõde, totaalsus VI. 18.0-24.0 intimacy vs isolation eesmärk: lähisuhted positiivne lahendus: armastus (love) intiimsus negatiivne lahendus: üksildus rituaal: lähisuhted
In spite of the advantages of tourism, there can be many disadvantages too, as there are always two sides of everything. First of all, tourists cause pollution. Increased pollution disturbs local residents and also it may discourage tourists from further entering the country. Secondly tourists don't always respect traditional cultures and cultures can be broken down as a result of tourism. The country may lose its original values and a sense of identity. The local residents might just start following the way tourists live. For conclusion, even though tourism carries a lot of disadvantages, it is still a positive thing, because it developes countries. So yes, countries should encourage tourism. Kairi Vald 12b
OVERVIEW WHEN HIS BROTHER IS KILLED IN A ROBBERY, JAKE SULLY DECIDES TO TAKE HIS PLACE IN A MISSION ON THE WORLD OF PANDORA. THERE HE LEARNS THE NATIVE HUMANOID NA VI AND KNOWS THAT IN ORDER TO MINE FOR THE RICH MATERIAL SCATTERED THROUGHOUT THEIR RICH WOODLAND. IN EXCHANGE FOR THE SPINAL SURGERY THAT WILL FIX HIS LEGS, JAKE GATHERS INTEL FOR THE COOPERATING MILITARY UNIT IS ON HAND GUNG-HO COLONEL QUARITCH, WHILE OPERATION ATTEMPTING TO INVESTIGATE THE NA'VI PEOPLE WITH THE USE OF AN "AVATAR" IDENTITY. WHILE JAKE BEGINS TO LEARN THE NA VI PEOPLE AND THE NATIVE, HE FALLS QUICKLY IN LOVE WITH THE BEAUTIFUL ALIEN NEYTIRI, THE RESTLESS COLONEL MOVES FORWARD WITH HIS TACTICS, FORCING THE SOLDIER TO TAKE A STAND - AND FIGHT BACK IN AN EPIC BATTLE FOR THE FATE OF PANDORA. SOUNDTRACK AND TRAILER • HTTP:// UPLOAD.WIKIMEDIA.ORG/WIKIPEDIA/EN/1/18/JAMESHORNERAVATARCLIP.O GG • HTTPS://WWW.YOUTUBE.COM/WATCH?V=CRDXXPV9GNQ THE END!
country. The main problem or conflict the characters have to solve Families like Meena's are trying to work out how they fit into British society while attempting to maintain their own culture. Meena's house is always full of a constant stream of ethnic visitors and her parents seem to see no need to integrate further, but Meena finds them baffling. It seems as if racism is a great probleem for Meena since she does not feel that she belongs to the English or the Indian identity. Meena's is caught between two cultures. She and her family also have to deal with racism and narrow-mindedness in the village. How was the conflict solved? What is your opinion of the solution? Meena tries to reinvent her life and her past in order to make herself more interesting and in some sense to fit the stereotypes. She is very much the opposite of her mother, who has managed quite well to find her Indian/English identity and is upset by Meena's lies
24.03.09 The ideal school for my children The ideal school for my children would be communication-based, blending aspects of social work, conflict resolution, team building, and traditional learning. Classes would be limited to fifteen students, a size small enough to allow individual attention but large enough to furnish the feeling of belonging to a group. In addition, academic lessons would be split into two halves. The first half would be a basic skills seminar, and the second an advanced class. Students would be able to choose whether to stay the second half, or else they could leave to work on their current project, read, or pursue an independent study of another subject. The students who stayed - the "second halfers" - would be known as the students with the greatest passion for the subject. No grades ...
``Love medicine`` Louise Erdrich Introduction My name is Karl-Erik Lett. The title of my book is Love medicineand the autor of this book is Louise Erdich. This book was Publisher in 1984. I really enjoyed reading this book, seeing events from different point of views was facinating and made reading interesting. I chose this book because of its interesting title. Native American government policy is a recurrent topic, especially because the Kashpaw family is (according to Nector) “respected as the last hereditary leaders of this tribe. Loss of a cultural identity and Native American spirituality characterizes and separates the two generations in Love Medicine: “They gave you worthless land to start with and then they chopped it out from under your feet. They took your kids away and stuffed the English language in their mouth.” The generations that Erdrich covers exp...
Other games included corn, your opponents from cane, and moccasin games. hitting it. Chunkey player Language English, Choctaw The Choctaw language belongs to the Muskogean linguistic group. Closely related to Chickasaw, some linguists consider the two dialects a single language The Choctaw language is the essence of tribal culture, tradition, and identity. Religion Protestant, Roman Catholic, traditional beliefs Good spirit and an evil spirit. Sun, or Hushtahli, worshippers. Prayers may have been introduced by missionaries. Choctaw prophets were known to have addressed the sun. Traditional clothing Dresses are made by hand Choctaw elders, dress in their traditional garb every day. Choctaw dresses are trimmed by full diamond, half diamond
/*PÄRING1 AVADA ANDMEBAAS MYYK*/ USE MYYK /*PÄRING2 LUUA TABEL ANDMEBAASI*/ CREATE TABLE dbo.kaup_tbl ( KAUBAID INT NOT NULL IDENTITY (1,1) PRIMARY KEY, KNIMI VARCHAR (10) NULL, KKOOD VARCHAR (3) NULL, HIND DECIMAL (6,2), ) /*PÄRING3 LISADA KAUBAD TABELISSE*/ INSERT INTO dbo.kaup_tbl (KNIMI,KKOOD,HIND) VALUES ('PLUUS','K1',245.20) INSERT INTO dbo.kaup_tbl (KNIMI,KKOOD,HIND) VALUES ('PYKSID','K2',765.40) INSERT INTO dbo.kaup_tbl (KNIMI,KKOOD,HIND) VALUES ('KINGAD','K3',1267.45) INSERT INTO dbo.kaup_tbl (KNIMI,KKOOD,HIND) VALUES ('SAAPAD','K4',983.35) INSERT INTO dbo.kaup_tbl (KNIMI,KKOOD,HIND) VALUES ('SOKID','K5',34.30)
networking sites, there are no boundaries as to where and when you can message or even videocall someone. However, all the information put on the Internet leaves a trace. It can not be deleted and it can be easily found by anyone who is interested. This can be harmful, as more and more employers are conducting background checks on their future employees. Some foolish jokes and posts about parties may cost people their dreamjobs. What is more, private details put online can lead to identity theft or fraud. Every piece of personal information added to the profiles, are added risks to being the victim of such crimes. Fraudsters can use even a seemingly pointless piece of information to their benefit and for example wipe out your credit card. Fortunately, nowadays social networking sites are constantly improving their security settings and try to avoid such events. To sum up, social networking is an essential part of an increasing amount of people. It is very
„Association of Southeast Asian Nations (ASEAN)“ – Kagu-Aasia Maade Assotsiatsioon ASEAN ehk Kagu-Aasia Maade Assotsiatsioon kasvas välja selle liidu nii-nimetatud eelkäijast, milleks oli Kagu-Aasia Liit (ASA, Association of Southeast Asia). Kagu-Aasia Maade Assotsiatsioon sai alguse 8. augustil 1967, kui Tai pealinnas Bangkokis allkirjastati ASEAN-i deklaratsioon (Bangkoki deklaratsioon). See deklaratsioon allkirjastati ASEAN-i asutajariikide poolt, nimelt siis Indoneesia, Malaisia, Filipiinid, Singapur ja Tai. [1] 1967. aastast kuni 1984. aastani püsis liit muutumatuna, ei olnud lahkujaid ega liitujaid. 1984 7. jaanuaril liitus ASEANiga väike Brunei riik, viies liikmete arvu viielt kuue peale. 11 aastat hiljem liitus Vietnam (28 juuli 1995), 1997. aastal Laos ja Birma (tuntud kui ka Myanmar) ning viimasena 1999. aprillis Kambodža. Tänaseks on ASEAN-i koosseisus kõik kümme eelmainitud riiki: Indoneesia, Filipiinid, Singapur, Tai, Bru...
Finally, all of the countries work together to protect the environment and to fight against the global problems, such as terrorism. On the other hand, the joining into the European Union brings some cons for country. Firstly, despite the poor state of the country, it has to help other Member State, if it has some kind of problem. Secondly, prices on food for example can grow up, because of despite the European Union has a single market. Moreover, it is a challenge for national identity, because there are a large number of refugees and immigrants, who brought with another culture and customs. Also, the country can lose skilled young workers, who go to another country to live and work. To sum up, the only reason the countries are entering the European Union is they feel it makes their country stronger and better economically. This union gives them a lot of benefits, but it is necessary to obey some EU laws.
What would help to preserve peace in the world. Also a world government would help to rationalize recourses. As there would not be any duplicating, allowing much faster development of new technologies and faster production. In addition recourses would not pile up in one place because they would be diverted to places where the need is greatest. But there is a downside to a world government. Through unification of people and countries, smaller nations would lose their identity. It means smaller nationalities would simply fade away, they would be dissolved. Because the influence of other cultures would be too great. A world government is necessary if we wish to thrive in the future. Although it comes with the cost of losing the identity of smaller nations. Problems of 21th century city The cities of the 21th century are the biggest mankind has created besides incorporating
narrative. Natural viewpoint gives the improvised feel of the action , despite that lines seem spontaneous evan as they are exactly the opposite. Altogether, ''La Règle du Jeu'' is an outstanding and non-judgmental film, a commentary on human behavior and charitable to its protagonists. Despite handling a number of thematic direction, Renoir's clarity of approach is such that these remain distinct. For example, the theme of mistaken identity, where one person substitutes for another (such as at the masquerade ball), is introduced at the airport and continues throughout. Together with the direct interpretation, every member of this upper-middle class social group is required (as a matter of course) to hide their true feelings, their identity. It is this complexity, presented in simple terms. Renoir subtly builds his case against the aristocracy, collapsing his house of cards only at the very end.
Film review Seven pounds The film ,,Seven pounds" is a drama about a man named Ben, who changes the lives of seven people. Will Smith plays the main character Tim Thomas, who's under the identity of Ben Thomas. The film was released in 2008. Tim Thomas causes a car crash. Seven people died. Because of that, Tim decides to save the lives of seven good people, who deserve being alive. He donates a lung lobe to his brother, a liver to a child services worker Holly, a kidney to a junior hockey coach, bone marrow to a young boy Nicholas. He also helpes a woman who lives with an abusive boyfriend. Tim gives Connie and her kids his beach house. He also
confidence confident l government governmental neighbor neighboring gratitude grateful identity identical crime criminal monument monumental myth mythic naturalist naturalistic continent continental
, , , , , , , , , , , . Bluetooth , 10 -- 100 ( ), . IPTV IP, .Juhtmepõhine juurdepääas:ADSL -- , . . , , , .ADSL (0,3 -- 3,4 ) , ADSL (26 -- 1.4 ). , .PON -- . PON, , . PON , , .Mobiilvõrkude sõlmed: NMT 453 468 . GSM , TDMA . .GMSC . EIR . IMEI(international mobile equipment identity. HLRhome location registry . VLR visitor location registry. AUC. , . HLR. : ( ) , , , .UMTS(universal mobile telecommunication system) võrgu juurdepääs ja
· Distinctive cultural features have also arisen from Australia's natural environment and Indigenous cultures · Since the mid-20th century, American popular culture has strongly influenced Australia, particularly through television and cinema · Other cultural influences come from neighbouring Asian countries, and through large-scale immigration from non-English-speaking nations HUMOUR · Comedy is an important part of the Australian identity · The unique character and humour of Australian culture was defined in cartoons by immigrants and in the novel They're a Weird, which looks at Sydney through the eyes of an Italian immigrant · The annual Melbourne International Comedy Festival is one of the largest comedy festivals in the world, and a popular fixture on the city's cultural calendar VIDEO https:// www.youtube.com/watch?v=6leHGHCKeSg&spfreload= 10 Thank you for watching!
seda propageerivad. Lõhestunud valija on aga see, kellel on nii struktuurne, kui väärtushinnanguline pool esindatud. Näiteks kõrgklassi konservatiiv, kellel on parempoolne vaade majanduslikest teemadest (Toka). Enda uuritavates andmetes katsun siis kasutada seda Gabor Toka valija tüüpide määramise mudelit, et kas valija on siis antud juhtudel pigem väärtushinnangute põhine, lõhestunud või struktuuriline. BARTOLINI, Stefano and MAIR, Peter: Identity, Competition and Electoral Availability. The Stabilization of European Electorates 1885-1985. Cambridge, Cambridge University Press, 1990. KNUTSEN, Oddbjorn and SCARBROUGH Elinor: «Cleavage Politics» in VAN DETH, Jan W. and SCARBROUGH, Elinor (eds.): The Impact of Values. Oxford, Oxford University Press, 1995.
` PÕHIMÕTE: Autori(te) nimi/nimed, initsiaal(id) (Ilmumisaasta). Artikli pealkiri. Ajakirja nimi, aastakäik(vihik), artikli leheküljed. Valisin kvalitatiivse artikli ülevaate tegemiseks teadusartikli: Chambers, S.; Canvin, K.; Baldwin, D.; Sinclair, J.(2017) Identity in recovery from problematic alcohol use: A qualitative study of online mutual aid. Drug and Alcohol Dependence, 174, 2017, 17-22. Loetud allikast https://ac-els-cdn-com.ezproxy.utlib.ut.ee/S0376871617300819/1-s2.0- S0376871617300819-main.pdf?_tid=d8eafa84-c617-11e7-bf35- 00000aab0f02&acdnat=1510319318_27d2a1485213b455bc7b9363651875ce Artikli eesmärgiks on uurida, mil määral aitab liitumine ühe kindla ja kõigile avatud
Wood Houses, fencepoles Taiaha traditional weapon, tool handles Stone Tools Bones Fish hooks, needles Performed by men only TA MOKO TATTOO Permanent body and face marking Status and rank Attractiveness TRADITIONA L TEXTILES Pake/Hieke a rain cloak for winter Piupiu a grass skirt Korowai, kaitaka, kahu huruhuru and kahu kur fine cloaks PAINTING Concentrated mostly on landscape and Mori subjects KAPA HAKA MAORI PERFORMING ART Expressing their heritage and cultural identity SPORT Rugby, basketball, cricket, hockey Extreme sports, adventure tourism and strong mountaineering tradition All Blacks THANK YOU FOR YOUR ATTENTION
My ideal school. My ideal school would be communication-based, blending aspects of social work, conflict resolution, team building, and traditional learning. Classes would be limited to fifteen students, a size small enough to allow individual attention but large enough to furnish the feeling of belonging to a group. Creative projects would be the cornerstone of the curriculum, incorporating all the life skills that make this method of education unique. The class would be presented with a number of ideas at the beginning of each project, and would also have the option of coming up with their own idea. Some examples are raising money to donate to a charity, creating an anthology of short stories to be bound and published, starting a website, writing and recording an original song, and patenting a new idea. Because of the amount of coordination required for each project, both successes and failures would inevitably ...