English culture. The modern global game of Football was first codified in 1863 in London . England is the joint oldest national team in the world, along with the Scotland national football team. The first recorded women's football match in England was more than 100 years ago but it is only in recent years that women's football has begun to receive some serious attention, in the form of televised matches (such as the FA Women's Cup final and matches of the national team), international games being held at larger stadia and, to a lesser extent, the comedy film Bend It Like Beckham.
organized rules http://volleyball- magic.net/reviewsite/ Basketball *Basketball is a sport ,which is played with a leather ball and two baskets. *It involves dribbling,running,passing,jumping and shooting. There are : * Violations. *Fouls,which they are Flagrant, Personal and Technical. Football *The length of the pitch for international adult matches is in the range of 100110 m and the width is in the range of 6475m *The game played by over 250 million players, making it the http://en.wikipedia.org/wiki/A world's most popular ssociation_football sport. Football leagues Some countries top divisions feature highly paid star players; in smaller countries and lower divisions, players may be part-timers with a second job, or amateurs. The five top European leagues the Premier League (England)
thesauri, newswire articles, and literary works Operation • Parses the clues into fragments • Executes thousands algorithms simultaneously • The more algorithms that find the same answer the more likely Watson is to be correct • Checks if potential solution makes sense • Dynamic learning History • Development started in 2005 • First initial tests in 2006 • First successful tests in 2008 • Jeopardy matches in 2011 Future plans • Clinical decision support • Watson Engagement Advisor • Research • Build new Watson-powered apps Thank you for your attention
to the oponent. An offside isi s whistleled or usually shown with a flag by the assistent refree when a player is closer to the opponents goal at the time of the pass then any ohter oponent exept goalkeepr. An offside doesn't count when the player passing the ball is also in offside. Substitution A substitution is made by the couch. It means that he can replace one player in his/her team incase he wants too or a player cant continou playing. In official matches up to 3 substitutions are allowed in a game and the decision is made during the game vased on the players performance. Usuallt the substitute bench consists of 1 goalkeeper,2 defenders 2 midfielders and 2 strikers. Rarely a team has to substitute both goalkeepers and a player whos not originaly a goalkeeper will have to do his best. Football unites peole and motivates peole to do sports. The down side is that during International matches where the competeing nations are represented by
Dear Sir/Madam I am writing to apply for the writer job which was advertised last week in the Financial Times. I would like to apply for the job because the conditions are excellent and the job perfectly matches my personal and professional interests. I think I would be the perfect candidate for the job because I like writing and humanities have always been my favourite studying subjects in school. I have also been blogging since two years and reading books and watching movies have always been my two favourite hobbies. I have also taken part in various writing competitions and in my free time I write reviews for the movies. If given the job I would do it part-time as I am still attending school.
GXN Horten Headquarter 10,000 m2 2009 Copenhagen, Denmark Shape which saves energy Material Fiberglass and travertine The "innovation" Fibreglass is a fiber reinforced Traventine form of polymer made of a plastic. Easily limestone deposited by mineral formed using molding processes. springs. Lightweight and extremely strong. Interior Optimum daylight conditions The spine of the building Matches with exterior Insulating foam core Two layers on fiberglass Layer of travertine "The building is a good example of how environmentally friendly objectives can be combined with beautiful architecture" - Kim Herforth Nielsen, creative director and founder of 3XN. Worth reading it? YES self shielding design isekaitsev disain? travertineclad traventiiniga kaetud
UNIT 14 (I) 1. Follow the road safety rules 2.Dangers 3.Right speed ... distance 4.Mp3 players ... mobile phones 5.Rd lights ... stop signs 6.Direction as the traffic 7. Any tricks on the road 8. The Pavement 9. A Crash Helmet 10. Brakes ... Wheels (II) 1.Although 2.Because 3.otherwise 4.because 5.Although 6.otherwise 7.Because (III) 1. Switch off all electrical appliances when you leave home 2. It's Dangerous to walk on a dark road without a reflector 3. Children mustn't play with matches because it might cause a fire 4. Have you ever had a car crash 5. It's dangerous to dive into the river in an unknown place 6. Do you always wear a crash helmet when you go cycling (IV) 1. Lives | 9. Realized 2. Was | 10. Stopped 3. Didn't Wear | 11. Was 4. Thinks | 12. understood 5. Noticed | 13. have learned 6. Didn't treat | 14. Don't try 7. Had Had | 15. 'm not 8. Didn't Make |
We all have had a childhood, we all got different memories. But not all memories aren't good. Kristo Karu tells a little bit about his childhood. When I was a child I liked to make troubles. Once I was cutting hammer handle into two pieces. Granddad punished me. Also I have been driving with sledge on very big puddle. Sledge didn't make it. I got very wet. Once I had been hitting chicken with bow arrow, granny saw me. This was very big trouble. I liked to eat matches when I found some. These tasted good. I spent very much time at granny's place when I was a child. Granny liked when I was there even I was very bad child. But I didn't like my granny, because she was very evil to me. I was afraid of her. Sometimes I hid myself into the shed. Granny was looking for me all day. But she didn't find me. This was Kristo's childhood. It didn't look good. All little children who are reading this article, DO NOT TRY THIS AT HOME.
2. Ülesanne , suurte tähtedega on vaja lünkadesse panna . I' ve come here BECAUSE you told me to. warm clothers OTHERWISE you ... ALTHOUGH the weather was .. Helmet BECAUSE it's too tight Let's clean .. OTHERWISE it .. Tom was taken ... ALTHOUGH .. 3. Ülesanne , vastused tõlkimisele . * Switch off all electrical appliances when you leave home * Cildren mustn't play with matches veacause it might cause a fire. * It's dangerous to walk on a dark road without a reflector. * Do you always wear a crash helmet when you go cycling? * It's dangerous to dive into the river in an unknown place * Have you ever had a car crash? 4. Ülesanne õiges ajavormis sõnad Mary LIVES in the North of England. Three years ago she WAS hurt because she DIDN'T WEAR a seatbelt.
Prom Hairstyles 2012 The most popular prom hairstyles are updos because they look very polished and formal Some of the popular styles are French twist hairstyles and half up dos. A tiara hairstyle is very popular in proms as it creates a princess or queen look. When picking hair pieces, make sure it matches your jewelry too. Avoid going too overboard with the accessories. half updos style French twist hairstyles
training • One of the oldest fighting systems in existence • Originally practiced • The Sri Lankan martial art • Currently many other Indian states also practice this martial art MUSTI YUDDHA • Traditional South Asian form of boxing • Musti Yuddha term • Muki boxing from Varanasi • Panjab • Years of apprenticeship • Any part of the body may be targeted, exept the groin • Techniques incorporate • Boxers clothing • Matches SILAMBAM • Weapon-based Indian martial art • Silambam referred to the sound derive from swinging of the perambu a particular type of bamboo from the Kurinji hills in southern Indian sub continent • Named after its primary weapon • Nillaikalakki discipline • The styles differ from one another in grip, posture, foot work, length of the stick VARMA KALAI • Indian term meaning "art of vital points“ • Component of many things
era received regular military training · One of the oldest fighting systems in existence · Originally practiced · The Sri Lankan martial art · Currently many other Indian states also practice this martial art MUSTI YUDDHA · Traditional South Asian form of boxing · Musti Yuddha term · Muki boxing from Varanasi · Panjab · Years of apprenticeship · Any part of the body may be targeted, exept the groin · Techniques incorporate · Boxers clothing · Matches SILAMBAM · Weapon-based Indian martial art · Silambam referred to the sound derive from swinging of the perambu a particular type of bamboo from the Kurinji hills in southern Indian sub continent · Named after its primary weapon · Nillaikalakki discipline · The styles differ from one another in grip, posture, foot work, length of the stick VARMA KALAI · Indian term meaning "art of vital points" · Component of many things
water energy · Reduce fuel consumption Forests are lit · Dumb people · The soil erosion · Inform people · Children playing matches · Loss of habitat · Forbit making fire in dry · Misusage of fire · Loss of biodiversity areas · Lightning · Heat Loss of biodiversity · All ecological problems · Loss of habitat · Protect our nature
In 1967, Ali refused to be inducted into the U.S. military, based on his religious beliefs and opposition to the Vietnam War. He was arrested and found guilty on draft evasion charges, stripped of his boxing title, and his boxing license was suspended. He was not imprisoned, but did not fight again for nearly four years while his appeal worked its way up to the U.S. Supreme Court, where it was successful. Heavyweight title Nicknamed "The Greatest", Ali was involved in several historic boxing matches. Notable among these are three with rival Joe Frazier and one with George Foreman, whom he beat by knockout to win the world heavyweight title for the second time. He suffered only five losses (four decisions and one TKO by retirement from the bout) with no draws in his career, while amassing 56 wins (37 knockouts and 19 decisions). How he became e cultural icon? Ali was well known for his unorthodox fighting style, which he described as "float
If the score is level at the end of the game, either a draw is declared or the game goes into extra time or a penalty shootout depending on the format of the competition. A number of players may be replaced by substitutes during the course of the game. The maximum number of substitutions permitted in most competitive international and domestic league games is three, though the permitted number may vary in other competitions or in friendly matches. Common reasons for a substitution include injury, tiredness, ineffectiveness, a tactical switch, or timewasting at the end of a finely poised game. A game is officiated by a referee, who has "full authority to enforce the Laws of the Game in connection with the match to which he has been appointed", and whose decisions are final. The referee is assisted by two assistant referees. In many high-level games there is also a fourth official who assists the referee and may replace another official
beginning of Tony and Pepper's relationship. Stark was also frequently helped by his friend James Rhodes who seemed to be really close to him. Even though it was hard to see, Tony Stark really appreciated his friends. A superhero is special because of his extraordinary powers, but typically still has personal problems all of us can relate to. Iron Man is a good example; he clearly has his strengths, weaknesses and something he values in life. He is unique but still matches the definition of a superhero. sources: http://articles.washingtonpost.com/2008-05-02/news/36833035_1_iron-man-tony-stark- obadiah-stane http://www.comicvine.com/iron-man/4005-1455/ http://www.the-spearhead.com/2010/05/10/iron-man-2-a-brief-interpretive-analysis/ http://daniellebowers.wordpress.com/2011/07/03/character-relationship-analysis-tony-stark- and-pepper-potts-ironman-2/ http://en.wikipedia.org/wiki/Tony_Stark http://en.wikipedia.org/wiki/Iron_Man_(film)
There are numerous other symbols and symbolic artefacts, both official and unofficial, including the thistle, the nation's floral emblem, the 6 April 1320 statement of political independence the Declaration of Arbroath, the textile pattern tartan that often signifies a particular Scottish clan, and the Lion Rampant flag . · Flower of Scotland is popularly held to be the National Anthem of Scotland, and is played at events such as football or rugby matches involving the Scotland national team · St Andrew's Day, 30 November, is the national day, although Burns' Night tends to be more widely observed. Tartan Day is a recent innovation from Canada. In 2006, the Scottish Parliament passed the St. Andrew's Day Bank Holiday (Scotland) Act 2007, designating the day to be an official bank holiday. The National Dances The Flora McDonald's Fancy The Sailor's Hornpipe The Irish Jig Scottish Lilt Competition Dancing
Kokkuvõtteks arvan ma, et inimesed peaksid piirama televiisori vaatamist ja aktiivselt oma vaba aja veetmist Television is very popular nowadays. Is TV the most popular source where to get information. Almost everyone have an access to a TV. There are a lots of advantages and disadvantages of watching TV. Beginning with the first, we know what is going on all over the world. We know the weather forecast. We can see important events "live", especially sports events, for example : football matches, ski jumps, tennis matches etc. TV also presents lots of scientific programs and nature movies as well. Thus people can increase their knowledge about the world that is surrounding us. Watching a television is a good opportunity to spend a spear time. There are some really interesting programs about for example our hobbies. It can by also good way to spend the evening, watching comedy films. On the other hand, there are a lot of disadvantages. TV is a waste of
The British are fond of sports. The national sport of the UK is football, having originated in England, and the British have the oldest football clubs in the world. The first ever international soccer game was between Scotland and England in 1872. The match ended with a goalless draw. The British have been world champions notably only once. That was in 1966 when they won a victory over Germany. There are many others famous British sport competitions, which include the ashes series of cricket matches, The Wimbledon tennis championships, the Grand National etc. A great number of major sports originated in the United Kingdom, including: soccer, squash, golf, tennis, boxing, rugby, cricket, snooker, billiards, badminton and curling. Literature English literature emerged as a recognisable entity in the late 14th century. Geoffrey Chaucer is the first great identifiable individual in English literature: his Canterbury Tales remains a popular 14th-century work, which readers still enjoy today.
were used by over 2,000 people during the two competitions. Auckland Civic Theatre It's a famous heritage atmospheric theatre in downtown Auckland. It was renovated in 2000 to its original condition. Auckland War Memorial Museum It's a large multi-exhibition museum in the Auckland Domain, known for its impressive neo-classicist style. Eden Park It's the city's primary stadium and a frequent home for All Blacks rugby union and Black Caps cricket matches. It will be the location of the 2011 Rugby World Cup final. 8. What is its nickname? City of Sails, for its enthusiasm for the sport of sailing. 9. Describe the climate of Auckland. Auckland has a warm-temperate climate, with warm, humid summers and mild, damp winters. The average daily maximum temperature is 23.7 °C in February, and 14.5 °C in July. It is one of the sunniest spots in the country. It also has a high rainfall, which ensures the lushness of its rainforests.
abundance of fresh fruits, vegetables and seafood on the coast. Most people use fresh fruit to make their own beverages, which are called "local drink." Fresh fish and seafood are an integral part of the food of the rural areas and small villages along the coast. They also like a crab soup. Guyana plays international cricket as a part of the West Indies cricket team, and the Guyana team plays first class cricket against other nations of the Caribbean. Guyana played host to international cricket matches as part of the 2007 Cricket World Cup. But they also play a softball cricket and football. The minor sports are netball, rounders, lawn tennis, basketball, table tennis, boxing, squash, and a few others. Another aspect of Guyanese culture is its rich folklore about Jumbees.
forms part of the design of the Union Flag. There are numerous other symbols and symbolic artefacts, both official and unofficial, including the thistle, the nation's floral emblem, the 1320 statement of political independence the Declaration of Arbroath, the textile pattern tartan that often signifies a particular Scottish clan, and the Lion Rampant flag.Flower of Scotland is popularly held to be the National Anthem of Scotland, and is played at events such as football or rugby matches involving the Scotland national team. However, since devolution, more serious discussion of the issue has led to this being disputed. Language Historically, Scottish people have spoken many different languages and dialects. The Pictish language, Norse, Norman-French and Brythonic languages have been spoken by descendants of Scottish people. However, none of these are in use today. The remaining three major languages of the Scottish people are English, Lowland Scots (various dialects) and Gaelic
The government's major focus for the immediate future will be on measures to reverse the severe economic recession that started in mid-2008. Area: total: 505,370 sq km water: 6,390 sq km country comparison to the world: 52 land: 498,980 sq km Population: 46,754,784 Government type: Parliamentary monarchy Capital: Madrid Economy overview: Spain's mixed capitalist economy is the 13th largest in the world, and its per capita income roughly matches that of Germany and France. However, after almost 15 years of above average GDP growth, the Spanish economy began to slow in late 2007 and entered into a recession in the second quarter of 2008. GDP contracted by 3.7% in 2009, ending a 16-year growth trend, and by another 0.1% in 2010, before turning positive in 2011, making Spain the last major economy to emerge from the global recession. The reversal in Spain's economic growth
enough money and power to carry out revenge on his enemies. Faria is the first person that opens up Dantes' eyes so that he can see who his enemies really are. When Dantes first meets Faria, he is overjoyed because he hasn't seen another person, other than the guard, for years. Faria reaches Dantes by means of a tunnel that took him 3 years to dig with his makeshift tools. Even though he had limited resources, Faria made matches, a lantern, a ladder, and a knife. Faria hid all these tools behind two separate rocks in his cell. All of these things show how smart Faria really was. Faria's intelligence is what helps Dantes make his transformation. "There is a maxim of jurisprudence which says, `If you wish to discover the guilty person, first find out to whom the crime might be useful.' To whom might your disappearance be useful?" This quote makes it
The candles are usually red in color, and decorated with sprigs of holly. Irish women bake a seed cake for each person in the house. They also make three puddings, one for each day of the Epiphany such as Christmas, New Year's Day and the Twelfth Night. After the Christmas evening meal, bread and milk are left out and the door unlatched as a symbol of hospitality. St Stephen's Day, the day after Christmas, is almost as important, with football matches and meetings going on. For children, the Wren Boys Procession is their big event. Boys go from door to door with a fake wren on a stick, singing, with violins, accordions, harmonicas and horns to accompany them. The reason for the ceremony is to ask for money 'for the starving wren', that is, for their own pockets. Children often put out Christmas sacks instead of stockings. It is tradition to leave mince pies and a bottle of Guinness out as a snack for Santa.
Victorian times Life and conditions of Victorian people Children were expected to help towards the family budget. They often worked long hours in dangerous jobs and in difficult situations for a very little wage. For example, there were the climbing boys employed by the chimney sweeps; boys and girls working down the coal mines, crawling through tunnels too narrow and low to take an adult. Some children worked as errand boys, crossing sweepers, shoe blacks, and they sold matches, flowers and other cheap goods. During the Victorian era, the population grew immensely. At the end of 19th century the population had grown three times bigger in Great Britain! That made wages much lower, because more people were looking for jobs. Many people couldn't afford places to live and had to live on the streets. Slums started appearing in bigger towns. Crime rate was also rising because of this: many homeless children lived by stealing and respectable Victorians started
" "Leave it to me then! I'm an expert in getting in trouble!" The red-haired girl smiled and wished her sister good luck. Then she hid under the bushes that were quite far away from the house. In the meanwhile Creasha had spotted dad's car. Evil smile on her face, she entered it. She was really surprised over finding a considerable amount of weapons there. Not even thinking she took them with her and stepped out. No one was still around. Then, a pack of matches fell from the weapon-suitcase. "Well, well, well what do we have here?" she asked herself and soon the car was exploding in the fire the girl had made. "Come!" she shouted to her sister and ran towards the first morning bus that was standing across the road. Suzan looked back the halfway and saw the terrible scene her whole house was on fire! She stopped and wanted to go back, but sister pulled her towards. Creasha cried, yet made herself and her twin sister continue their escape.
shift work-vhetustega t previous-eelmine manual dexterity-kteosavus knowledge job advertisements We are searching for a coock. The requirments include: -ability to handle a knife. -work on your own -ability to improvise -have good education(vocational) -have good body(wont get sick) avarge salary will be payed. sifts are a 8 hours a day. apprentced-1. korda tl(noor ttaja) when does the lunch begin? the lunch begins 12.15 1.3 1.8 1.9 1.11 1.17 1.19 1.20 1.22 a box of matches a jar of honey a tin of soup cherry apple pear oranges peaches to be addictive It lessens muscular control and co-ordination; it lengthens reaction time; it blurs vision and decreases awareness,especially in the dark; It impairs theability to judge speed and distance,and to deal with the unexpected. eyes are wierd and they cant move straight and they think slowly. millalalgab meie koolivaheaeg?When does our holiday start?It starts in june. Kuipalju maksavad need kingad
Some of the staff can speak Portuguese. Did any of your photos come out well? You can take any of these. Some is used: • with affirmative verbs: They bought some honey. • in questions where the answer ‘yes’ is expected: Did some of you sleep on the board? (I expect so.) • in polite offers and requests: Would you like some wine? Could you do some typing for me? Any is used: • With negative verbs: I haven’t got any matches. • With hardly, barely, scarcely (which are almost negatives): I have hardly any spare time. • With without when without any ...= with no ... : He crossed the frontier without any difficulty/with no difficulty. • With questions except the types noted above: Have you got any money? Did he catch any fish? • After if, whether and in expressions of doubt: If you need any money, please let me know.
iii. Sõna pikkus mis asi see on, mida ja kuidas mõjutab varieerimine. Otsingul meie sisestatud järjestus jagatakse juppideks. Sõna pikkus näitab jupi pikkust, siis leitakse need jupid, mis vastavad andmebaasi omadega, seejärel pikendatakse antud järjestust. Mida pikem sõna järjestus, seda vähem leitakse tulemusi, kuid tulemus on spetsiifilisem ja e- väärtus on väikesem. Word-size BLAST is a heuristic that works by finding word-matches between the query and database sequences. One may think of this process as finding "hot-spots" that BLAST can then use to initiate extensions that might eventually lead to full-blown alignments. For nucleotide- nucleotide searches (i.e., "blastn") an exact match of the entire word is required before an extension is initiated, so that one normally regulates the sensitivity and speed of the search by increasing or decreasing the word-size. For other BLAST searches non-exact word matches
d) This person might steal food from a supermarket e) This person kills someone on purpose f) This person takes people and demands money for their return. g) This person makes illegal copies of paintings, documents, etc. h) This person damages other people's property i) This person might steal your wallet in a crowd j) This person steals from houses k) This person gets money from others by threatening to tell secrets. 1) This person causes trouble at football matches Task 3. Complete each sentence (a-j) with a suitable ending (1-10). Use each ending once. a) I decided to buy a burglar alarm after someone broke 5 1 in by a salesman who cheated them out of their money. b) When Alan was stopped outside the supermarket he ended 2 away by stealing a car parked nearby. c) As it was Sheila's first offence she was let 3 up at the police station, charged with shoplifting.
- - at present the radio is very well developed so if you have a good receiver you are able to choose which kind of programs you like to listen to (PTY) - - you can also notify people about traffic jams and other events but not is spoken way but in words (RDS) There are also some disadvantages to a TV you can't see the `moving pictures' Kinds of programs: current affairs (news), discussions, music all kinds, culture, weather forecast, sport events and matches, breakfast radio... At present you can choose from lots of channels, some of them are state (which you can listen to everywhere in the state: CRo1) but most of them are private (they have many advertisements: Orion, Hellax, Radio City...). Broadcasting in GB The world famous British radio station is the BBC because they have their BBC World Service, which broadcast in 37 languages. - - the seat of the BBC is in London
earthquake floods invasion slums a) Food has been sent to areas in Africa suffering from …........................... b) Many people live in overcrowded…........................... on the edge of the city. c) The cost of…........................... has risen steadily this year. d) Thousands of buildings fell down during a severe …........................... e)…........................... at football matches has been reduced this year. f) The…........................... of Ruritania has been condemned by the United Nations. g) The eruption of the volcano was a terrible …........................... h) Hundreds of people drowned during the …........................... i) Two of those involved in the crash had serious …........................... j) Large cities face the problem of what to do with household …...........................
the 9th century as part of the Historia Britonum (you can see one or two of the surviving engravings of medieval football at the British Museum). Typically played during the annual Carnival, the other tag of `mob football' gives you a sense of what it was actually like to be involved in such games. Held between neighbouring towns and villages with no limit on the number of players and practically no rule book, matches often descended into riotous scenes. Indeed, so violent was medieval football that the Lord Mayor of London actually banned the sport in 1314, claiming `there is great noise in the city caused by hustling over large footballs in the fields of the public'. The extent of its popularity and rambunctiousness is reflected in the fact there were more than 30 royal and local laws which attempted to ban football between 1314 and 1667
This is also very on ka väga hea selles hinna ulatuses good in this price range. /hinnaklassis? 37. Kui te otsite midagi väiksemat, kui meil on If you are looking for smth smaller, then we see… have this one. 38. See on armas värv ja sobib teie............. It's a lovely colour, it matches your... kokku. 39. Ma võin teile kinnitada,et…. I can assure you that. 40. Mis te arvate? Kas see pole see, mida te What do you think about it? Isn't it what you vajate? need? 41. Kas te ei arva, et see on see (vajalik asi)…. Don't you think this is it... 42. Ma tean, et see (mingi kindel asi) on parim. I know that this one is the best.
summer. In London the Notting Hill Carnival takes place. Christmas Day - 25 December. Houses are decorated with evergreen, ivy and fir. Mistletoes hang above the doorways and the couples passing underneath must exchange kisses. Traditional foods are roast turkey, sweet mince pies, the Christmas pudding, a rich Christmas cake. Boxing Day - 26 December. In the shops there are Boxing Day sales and it is also known as a popular day for football matches and other sporting fixtures. English also celebrate other holidays like all the others in the world, such as Easter and Mother’s Day which is called Mothering Sunday in England. (Lent is a Christian holiday that was established in the 4th century as 40 days and is generally a period of fasting or other forms of self-denial. People generally eat a lot and have fun the day before Lent begins.)
.. ... ...", while also thinking of his long-lost wife. Throughout the novel he does not hesitate to kiss his son, initiate physical contact and openly express his fondness qualities which are not overly `manly' or adult, but rather emotional and child-like. In nature, he thinks " , !" .. ". Nikolais fondness of poetry is also deemed silly as he starts to quote verses by Pushkin in Chapter 2 " , -- , : , , , !" which is abruptly ended by Bazarovs request for matches. The aesthetic sense of the gentry is shown as Nikolai plays Schubert's "Erwartung" on his cello - albeit being not that skilful. As of Pavel he is beautifully appointed room is more likely a reflection of his social status and Anglomania than of any particular aesthetic sensibilities. Bazarov feels some kind of pity towards Pavel, he finds that a man must be his own master, not trapped in the aristocratic emotionality
which she compares with a beacon in the murky air. a turtleneck (2) - Example. Definition: (AmE) a `turtleneck' is a sweater with a high part fitting closely around the neck. (BrE `polo neck') (Oxford Advanced Learner's Dictionary. 6th edition.) Situation: When Andy, the engineer that June meets in the bar, peels a pink egg for her, saying that it matches her turtleneck, she corrects him, explaining that the item of clothing is called a shell, to which the man jokingly replies that he could peel that for her, too. dormancy (7) - the state of being dormant. Situation: Albertine explained that between her and her mother was an abuse, which required periods of dormancy. fallow (11) - a piece of fallow land. Situation: tattered grey windbreaks bounded flat,
I'm not very much a football player myself but I really like to watch the games on TV. Sometimes I play football with my classmates at the gym lessons. There are many reasons why football is my favorite game: I like it because it is exciting and challenging, it teaches teambuilding, discipline as well as teamwork. And probably the fact that my friends consider football as their favourite sport, has influenced my choice as well. Although I have seen a lot of football matches on TV, I have unfortunately had only one chance to go and see the game in the field. This was an experience I would like to repeat. It was much interesting to watch the game in the real field and I was much more excited about the game. Football is a team sport played between two teams of eleven players each. It is a ball game played on a rectangular grass field with a goal at each end. The objective of the game is to score by maneuvering the ball into the opposing goal. The winner is the team
had the chance to fight Stilson one to one. Surprisingly to everybody he knocked Stilson down, and he thought that tomorrow would be an even worse day if he'd left now. So he decided to win all the coming fight also, ha started to beat Stilson with his leg to his ribs, face, even his groin, and left when he was bleeding quite bad. Later colonel Graff came to the Wiggin house and asked Ender, why he had done so. He said that he had to win all the upcoming matches as well, not to get beaten up later himself. Graff said he was accepted and gave Ender the choice, to stay home or go to the Battle School. He chose to leave his beloved sister and go. Most of the book is set in Battle School. Graff makes every other launchie hate him since the start. Graff has decided that he has to isolate Ender, so that he would keep improving to become a genius that was needed. Soon Ender is put into an army, older boys were divided
..............................................................................................................2 A.2.2.1 Kirjeldada infotehnoloogianõuded antud organisatsioonilistes stsenaariumides. Discribe differing IT requirements within given organisational scenarios...................................................................................................2 A.2.2.2 Kirjeldada vastavus organisatsiooniliste vajaduste ja infotehnoloogia vahel. Design appropriate matches between organisational need and IT........................................................................................................................... 3 A.2.2.3 Koostada tehnoloogia mõju analüüs antud olukorra kohta. Compose a technology impact statement within a given situation...............................................................................................................................................3 A.2
diagram is a guitar neck. As I said above the Jamorama chord diagrams are going to be pictures of an `actual' guitar neck so it's easy to make the connection between strings and fingering. There is also a picture of the type of chord diagram that appears in most other Guitar learning guides. I want you to be aware of that form of `standard' chord diagram because you may want to use it when writing up chords on paper at home. So, now that you know what a chord diagram looks like and how it matches with the neck of your guitar, it's time to come back to what I said earlier about a chord being a combination of 3 or more notes played together. Finger placing symbols are added to the chord diagram so we know which notes to play. To start with, let's look at your fingers. We give each playing finger a number that we can then match up on the chord diagram (see below). And now, let's look at a full chord diagram
investigation will be further compiled in a form of booklet with review of best practices to serve as a ready-to-use material for EFL teachers, trainers, educators and other workers in the field. It is assumed that I will have an opportunity to conduct multiple case studies in different classrooms with students of different backgrounds and age range. The data will be collected experimentally, the analysis will be interpretive. Choosing the paradigm of research methodology, the method matches with experimental-quantitative-interpretive with experimental design, quantitative data and interpretive analysis (Nunan, 1992, pp. 46). It will also have the statistical data which will further prove to stand either for or against my hypothesis. Due to the fact that thesis is on its very first stage and it is impossible to foresee the step-by-step progression of the study, there is a problem with logical aspect of experimental research. However, it is clear that in order for an experimental
usually related to the rice harvest. Notable matsuri often feature processions which may include elaborate floats. Preparation for these processions is usually organized at the level of neighborhoods, or machi. Prior to these, the local kami may be ritually installed in mikoshi and paraded through the streets. One can always find in the vicinity of a matsuri booths selling souvenirs and food such as takoyaki, and games, such as Goldfish scooping. Karaoke contests, sumo matches, and other forms of entertainment are often organized in conjunction with matsuri. If the festival is next to a lake, renting a boat is also an attraction. Favorite elements of the most popular matsuri, such as the Nada Kenka Matsuri of Himeji or the Neputa Matsuri of Hirosaki, are often broadcast on television for the entire nation to enjoy. Some examples of famous matsuri are the Jidai, Hadaka Matsuri, Aoi and Gion Matsuri held
ncbi.nlm.nih.gov/) (3) "CpG island"i identifitseerimine inimese kromosoomis (BLAT programm, http://genome.ucsc.edu/cgi-bin/hgBlat) 109 nukleotiidi CCGCGGGTCGGCGGGGAGGTTGGGCCCAGGGATAAAAGAACTGGGGCTGGTGGGGGGGA GGGGTTCCCGGCCTAGGGGAAGGGCTATGACAATGGAATGACAACCGCGG Homo sapiens chromosome 15 genomic scaffold, alternate assembly CHM1_1.0 Sequence ID: ref|NW_004078084.1|Length: 73034944Number of Matches: 1 Related Information Map Vieweraligned genomic context Range 1: 36420564 to 36420672 GenBank Graphics Score Expect Identities Gaps Strand 202 bits(109) 8e50 109/109(100%) 0/109(0%) Plus/Plus Features:
But are there more advantages than disadvantages? In the first place, television is an entertainment. But it is not only a convenient entertainment. For a family of three, four or five, for example, it is more convenient and less expensive to sit comfortably at home than to go out to find entertainment in other places. They don't have to pay for expensive seats at the theatre or cinema. They turn on the TV-set and can watch interesting films, concerts, football matches. But some people think that it's bad to watch TV. Those who watch TV need do nothing. We are passive when we watch TV. Television shows us many interesting programmes. But again there is a disadvantage here: we watch TV every evening, and it begins to dominate our lives. My friend told me that when his TV-set broke down, he and his family found that they had more time to do things and to talk to each other. There are other arguments for and against television.
Mit seinem insgesamt 15. Grand-Slam-Titel stellte der Schweizer einen neuen Tennis- Weltrekord auf.[62] Da der Titelverteidiger und Weltranglistenerste Rafael Nadal seine Teilnahme an Wimbledon aufgrund einer Verletzung abgesagt hatte, konnte Federer durch seinen sechsten Wimbledon-Erfolg den ersten Platz in der Weltrangliste nach einer Unterbrechung von 46 Wochen zurückerobern.[62] Bei der anschliessenden nordamerikanischen Hartplatzsaison endete Federers Siegesserie nach 21 Matches im Viertelfinale von Montreal gegen Jo-Wilfried Tsonga. Eine Woche später bezwang Federer Novak okovi im Finale von Cincinnati und konnte seinen vierten Saisonerfolg feiern, wobei er im Halbfinale des Turniers auch erstmals seit vier Partien wieder Andy Murray bezwingen konnte.[63] Damit startete Federer erneut als Topfavorit und nach einer Unterbrechung von zwei Grand-Slam- Turnieren auch wieder als topgesetzter Spieler in die US Open. In Flushing Meadows
sentences before choosing words, cub whose mother had been killed as they may seem to require one by poachers. She was in a very word before the gap, but after the poor condition after being sold and gap, the sentence may change ordered to be stuffed by her new direction. Students re-read their owner. A local man was hired to do answers to make sure that their the job, which fortunately he was answer matches the grammar and unable to start because the cub sense of the text. managed to get loose. She arrived Photocopiable © Oxford University Press 8 Maturita Solutions Upper-Intermediate Workbook Key Unit 5 letter was about and Kevin replied
Peer-to-peer architectures Peer to peer (p2p) systems are decentralised systems where computations may be carried out by any node in the network. The overall system is designed to take advantage of the computational power and storage of a large number of networked computers. Most p2p systems have been personal systems but there is increasing business use of this technology. Torude ja filtrite arhitektuur Eelised: Easy to understand and supports transformation reuse. Workflow style matches the structure of many business processes. Evolution by adding transformations is straightforward. Can be implemented as either a sequential or concurrent system. Puudused: The format for data transfer has to be agreed upon between communicating transformations. Each transformation must parse its input and unparse its output to the agreed form. This increases system overhead and may mean that it is impossible to reuse functional transformations that use incompatible data structures.
new growth forms/AW; harvest after a number of years/process repeated; rotational coppicing/AW; ref to how coppicing increases biodiversity e.g. increasing light intensity; max 3 (ii) (standards) large planks/AW; A used as timber A standards more valuable/AW (coppice) small diameter wood/fencing/hurdles/garden furniture/charcoal/firewood/matches; (coppice) continuous, source of timber/income; recreational use/nature reserve; A ref to tourism max 2 [5] 20. release of carbon dioxide; from fungal respiration; available for photosynthesis/carbon fixation; extracellular digestion; named enzyme(s);