Vajad kellegagi rääkida?
Küsi julgelt abi LasteAbi
Logi sisse
Ega pea pole prügikast! Tõsta enda õppeedukust ja õpi targalt. Telli VIP ja lae alla päris inimeste tehtu õppematerjale LOE EDASI Sulge

"translatsioon" - 298 õppematerjali

translatsioon e. Valgusüntees. • Toimumiskoht: ribosoomid, mitokondrites, polüsoom • Toimumisaeg: kogu raku elutegevuse vältel • Komplementaarsus: mRNA: AUGC – tRNA:UACG • Vajatakse: - Energia(ATP) - Aminohapped - RNA molekule(kõiki kolme tüüpi) - Ensüüme - Valgulisi faktoreid • Etapid: - mRNA ühineb ribosoomiga - esimene tRNA molekul seondub mRNA initsiaatorkoodoniga - ribosoomi siseneb teine tRNA - kahe tRNA otstes oleva aminohappe vahele sünteesitakse peptiidside.
thumbnail
2
pdf

Translatsioon

7.3 Valgusüntees. Uus õpik lk 109 - 113 TRANSKRIPTSIOON JA TRANSLATSIOON Vasta küsimustele lõigu põhjal! a) Milleks vajab inimene valke? Mis juhtub, kui inimene vajab mingit valku? b) Millega algab ja kus toimub valgusüntees? c) Mis viib informatsiooni tsütoplasmasse? Mis ülesanne tal veel on? Iga elusorganism sünteesib vajalikud valgud Valkude süntees algab mRNA sünteesiga vaid 20 aminohappest. Arvatakse, et inimese rakutuumas ehk transkriptsiooniga. Valmis organismis sünteesitavaid valke on u 40 000

Bioloogia → Bioloogia
29 allalaadimist
thumbnail
26
ppt

REPLIKATSIOON, TRANSKRIPTSIOON, TRANSLATSIOON

TULEMUS 2 terviklikku DNA Tekib 3 eri vormi RNA-d: molekuli, kuna tRNA, mRNA, rRNA replitseeruvad mõlemad ahelad ERINEVUSED Matriitsiks terve Matriitsiks lõik DNA-st molekul Tekib kolme eritüüpi Tekib 1 molekulide molekule vorm Transkribeerub ühe ahela Replitseeruvad lõik mõlemad ahelad Translatsioon RNA alusel valgu süntees ribosoomidel Vajalikud tingimused: ribosoomid, mRNA, tRNA, aminohapped, energiat (ATP,GTP), ensüümid aminohapete aktiveerimiseks, nende seostumiseks tRNA-ga ja peptiidahela sünteesiks mRNA primaarstruktuur määrab ära valgu primaarstruktuuri Koodipäike Initsiaatorkoodon - AUG mRNA-s (metioniin) Stoppkoodon - ei kodeeri aminohappeid: UAA, UAG, UGA Geneetiline kood - süsteem, mille abil nukleiinhapetes olev info viiakse üle valgule

Bioloogia → Bioloogia
84 allalaadimist
thumbnail
6
docx

Replikatsioon, transkriptsioon, translatsioon.

rakkudesse. 2 täpselt ühesugust DNA molekuli DNA-ahelaga komplementaarne üheahelaline RNA-molekul DNA ahela kopeerimine enne raku RNA ahela süntees DNA-s oleva jagunemist info alusel. Rakutuum Rakutuum DNA DNA Komplementaarsuse printsiip Komplementaarsuse printsiip 2. Miks on replikatsioon, transkriptsioon ja translatsioon universaalsed? Replikatsioon, transkriptsioon ja translatsioon on universaalsed, sest need protsessid toimuvad ühtmoodi kõigis elusorganismides. 3. Milles seisneb PCR meetodi tähtsus? PCR meetodi võimaldab isikute kindlakstegemist. Väikese DNA- lõigu paljundamine kiiresti tuhandeid kordi. 4. Millest koosnevad valgud? Milline side selles polümeeris on? Milleks meil valke vaja läheb?

Bioloogia → Bioloogia
65 allalaadimist
thumbnail
2
docx

Translatsioon ja selle regulatsioon

Translatsioon Translatsioon- valgu süntees toimub tsütoplasmas, ribosoomides Translatsioon- protsess, mille käigus sünteesitakse liigiomaseid valke kõikide talitluste läbiviimiseks organismis. Valgud on liigiomased, st sünteesitud päriliku info alusel. Selle protsessi aluseks on mRNA molekulid. Translatsiooni protsess toimub ribosoomides. mRNA molekulis on geneetiline kood, mis määrab valgu molekuli aminohapete järjekorra. Geneetiline kood seisneb kolmes järjestikulises nukleotiidis ehk ühes koodonis, millele vastab kindel aminohape. Geneetiline kood on looduses universaalne, st kehtib kõikide elusorganismid e valkude ülesehituses. Koodonite ja aminohapete seoseid kujutatakse koodipäikese abil. Ühele aminohappele võib vastata kuni 6 erinevat koodonit, kuid üks koodon vastab alati ühele kindlale aminohappele. Üks ja sama nukleotiid mRNA ahelas ei kuulu üheaegselt kõrvutiasetsev atesse koodonitesse. Esimeseks koodoniks mRNA molekulis on...

Bioloogia → Geneetika
37 allalaadimist
thumbnail
2
doc

Pärilikkus,replikatsioon,transkriptsioon,translatsioon

Genoom ­ liigiomane ühekordne kromosoomistik. Genotüüp ­ ühe isendi geenide kogum Fenotüüp ­ isendi vaadeldavate tunnuste kogum Fenotüübi kujunemist mõjutavad genotüüp + keskkond. Keskkond kas soodustab või pidurdab geenide poolt määratud tunnuste väljakujunemist. Molekulaargeneetika- teadus, mis uurib pärilikkust molekulaarsel tasandil. Matriitssüntees ­ uus molekul sünteesitakse olemasoleva molekuli järgi. Need on replikatsioon, transkriptsioon, translatsioon. REPLIKATSIOON -DNA kahekordistumine -matriitssüntees -toimub rakutuumas, interfaasis -universaalne(toimub kõikides organismides ühtemoodi) -tulemus: jagatakse tütarrakkudele sarnane pärilikkusinfo TRANSKRIPTSIOON -RNA süntees -toimub rakutuumas, interfaasis -universaalne protsess -viib läbi ensüüm, mis peab seostuma vastava geeni alguosaga

Bioloogia → Bioloogia
148 allalaadimist
thumbnail
1
docx

Pärilikkusega seotud mõisted

talitluselt vanematega, muutlikkus ­ elu omadus, mis väljendub liigilises mitmekesisuses, liigilises populatsioonis, liigisiseses populatsioonide lahknevuses ja populatsiooni isendite omavahelistes erinevustes, (pärilik e geneetiline: kombinatiivne,mutatiivne; mittepärilik e modifikatsiooniline), transkriptsioon (RNA süntees) ­ matriitssüntees, mille käigus saadakse DNA molekuli ühe ahela nukleotiidse järjestusega komplementaarne RNA molekul (mRNA, tRNA, rRNA), translatsioon (valgu süntees) ­ mRNA põhjal ribosoomides valguahela sünteesimine, mis on peamine osa valgu sünteesist, replikatsioon (DNA süntees) ­ matriitssüntees, mille tulemusena saadakse ühest DNA molekulist kaks ühesuguse nukleotiidse järjestusega DNA molekuli, geen ­ lõik DNA molekulis, mis esineb alleelidena, alleel ­ ühe geeni erivorm, kromosoom ­ valgu abil kokku pakitud DNA molekul, mis sisaldab pärilikkus tegureid e geene, geneetiline kood ­ vastavus, kus mRNA kolm

Bioloogia → Bioloogia
8 allalaadimist
thumbnail
34
ppt

Geeni ekspressioon: translatsioon ja geneetiline kood

Geeni ekspressioon: translatsioon ja geneetiline kood Geeni väljendus on valk; kui rakul on vaja valku, siis tuleb lugeda vastavat geneetilist koodi. 1. Translatsioon mRNAl oleva info konverteerimine a/h järjestuseks ehk polüpeptiidiks Geneetilise info lugemine kahe etapiline: 1. Transkriptsioon ­ sünteesitakse DNA matriitsil üheahelaline RNA molekul DNA matriitsil Valk ehk proteiin: Suure mol.kaaluga, lämmastikku sisaldav orgaaniline ühend Sisaldab ühte või mitut polüpeptiidi. Polüpeptiidid koosnevad aminohapetest Aminohapped: Amino grupp (NH2)

Bioloogia → Geneetika
13 allalaadimist
thumbnail
3
doc

Rakud

Rakud - biopolümeeridest ehitatud isepaljunevad, diferentseeruvad ja erifunktsioone täitvad mikroskoopilised mullreaktorid Prokarüootsed rakud ­ bakterid - 1µm Eukarüootne rakk - >10µm Mullreaktor ­ rakus toimuvad reaktsioonid, rakk on reaktor, rakus toimub ainevahetus, metabolism Madalamolekulaasete ainete metabolismi põhiblokid - nende nimed - glükolüüs, Krebsi tsükkel, hingamisahel, pentoosfosfaaditsükkel,Madalamolekulaarsete ainete metabolismi põhiülesanded: tagada erinevatest substraatidest põhimonomeeride süntees, tagadarakuprotsesside energiaga varustamineRakkudes toimuvate tähtsamate reaktsioonide tüübid: "tavalised" ensüümreaktsioonid ­ Michaelis-Menten'i kineetika, molekulaarsed masinad: DNA replikatsioon, transkriptsioon,translatsioon, transpordiprotsessid filamentidel (kinesiin) ATP-süntaasid,lihasrakkude töö,mitoosis ja meioosis kromosoomide liikumine,viburid, ... Rakkudes on kõikide reaktsioonide jaoks katalüsaatorid (ensü...

Keemia → Biokeemia
90 allalaadimist
thumbnail
3
docx

Bioloogia 11. klassi materjal

- RNA-polümeraas sünteesib ühe DNA-ahela lõiguga komplementaarse RNA molekuli - RNA-polümeraas jõuab terminaatorini. - RNA liigub tuumast välja tsütoplasmasse · Tulemus ­ erinevate RNA'de süntees(mRNA, rRNA, tRNA Kui mingilt geenilt toimub RNA süntees siis öeldakse, et see geen avaldub. Üheaegselt avaldub u 10% geenidest. Selle tulemusena erinevad rakud oma ehituselt ja taktikaliselt. Translatsioon e. Valgusüntees. · Toimumiskoht: ribosoomid, mitokondrites, polüsoom · Toimumisaeg: kogu raku elutegevuse vältel · Komplementaarsus: mRNA: AUGC ­ tRNA:UACG · Vajatakse: - Energia(ATP) - Aminohapped - RNA molekule(kõiki kolme tüüpi) - Ensüüme - Valgulisi faktoreid · Etapid: - mRNA ühineb ribosoomiga - esimene tRNA molekul seondub mRNA initsiaatorkoodoniga

Bioloogia → Bioloogia
50 allalaadimist
thumbnail
3
pdf

Molekulaargeneetika põhiprotsessid

Molekulaargeneetika põhiprotsessid Kõiki neid protsesse nimetatakse ​matriitsünteesideks​. See tähendab, et uued molekulid toodetakse olemasolevate molekulide järgi. 1. Replikatsioon ​- DNA tootmine DNA järgi 2. Transkriptsioon ​- RNA tootmine DNA järgi 3. Translatsioon -​ Valgu molekuli tootmine mRNA järgi DNA replikatsioon - Toimub rakutuumas enne jagunemist - Vaja on: - Ensüüme (DNA polümeraas) - Vabasid DNA nukleotiide (6 miljardit) - Energiarikkaid ühendeid (ATP jt.) - Toimub vastavalt komplementaarsusele (G​≡​C, A=T) - Vaata pilti õpik lk. 17 → AATTGGCC → AATTGGCC Algne → TTAACCGG → Kaks identset DNA

Bioloogia → Bioloogia
13 allalaadimist
thumbnail
3
docx

Molekulaargeneetilised alused

Genoom- liigiomases ühekordses kromosoomistikus sisalduv geneetiline materjal(antakse alati arvuliselt) (Inimese genoom on 24 kromosoomi- sugukromosoomid X ja Y loetakse eraldi) Genotüüp- ühe isendi kromosoomistikus olev geenide ja nende eri vormide kogum Fenotüüp- ühe isendii vaadeldavate/avalduvate tunnuste kogum Pärilikkuse molekulaargeneetilised alused: · Molekulaargeneetikas saame rääkida kolmest põhiprotsessist: replikatsioon,transkriptsioon, translatsioon · Need on universaalsed protsessid · Kõik on matriitsünteesid(midagi valmistatakse millegi alusel ­ uute molekulide valmistamine toimub vanade molekulide alusel) · Molekulaargeneetiline dogma: kõik matriitsünteesid on omavahel seotud(järjekord on oluline) DNA(DNA replikatsioon)(transkriptsioon)- RNA(translatsioon)- proteiin · Replikatsioon- DNA kahekordistumine; enne raku jagunemist; rakutuumas; DNA- polümeraas; komplementaarsus A:T ja C:G

Bioloogia → Molekulaarbioloogia
32 allalaadimist
thumbnail
24
doc

Geenitehnoloogia

valgu biosünteesis. Kuna DNA primaarstruktuuris võivad nukleotiidid paikneda suvalises järjestuses, võimaldab DNA nende järjestuste kaudu talletada bioloogilist informatsiooni (seda võimaldab ka RNA, kuid DNA on oma suurema keemilise stabiilsuse tõttu pikaajalisemaks info säilitamiseks märksa sobivam ühend) 6. Kolm põhilist RNA-de klassi rakkudes, nende funktsioonid. mRNA(informatsioon) ­ RNA, mille molekulilt toimub translatsioon: informatsiooni-RNA nukleotiidijärjestuse põhjal sünteesitakse polüpeptiid. tRNA(transport) ­ tegeleb rakus aminohapete transpordiga ribosoomi, kus geneetilise koodi alusel lisatakse aminohape sünteesitavasse valguahelasse. rRNA(ribosoomis) ­ seostub valkudega kompleksideks ­ ribosoomideks (osaleb valgu sünteesis). 7. Prokarüootsete ja eukarüootsete rakkude peamised erinevused. Prokarüoodid on väiksemad, neil puuduvad histoonvalgud, DNA on nukleoidis (eukarüoodis DNA

Meditsiin → Arstiteadus
326 allalaadimist
thumbnail
2
docx

Geenide avaldumise häired ja kolm sünteesiprotsessi

Pärilikkuse kandjad on kromosoomid. Genoom ­ liigiomases ühekordses kromosoomikomplektis sisalduv geneetiline materjal. Geen ­ lõi DNAl, määrab ära RNA molekuli sünteesi. Genotüüp ­ ühele isendile omane geenide ja nende erivormide kogumik. Fenotüüp ­ ühe isendi vaadeldavate tunnuste kogumik. MOLEKULAARGENEETIKA: Kolm protsessi DNA süntees ­ replikatsioon RNA süntees ­ transkriptsioon Valgu süntees ­ translatsioon MOLEKULAARGENEETILISED PROTSESSID DNA ­ biopolümeer, mille monomeerideks on desoksüribonukleotiidid. Replikatsioon: Süntees, mille käigus saadakse ühest DNA molekulist kaks ühesuguse nukleotiidse järjestusega DNA molekuli. Protsessi viivad läbi ensüümid nagu helikaas, DNA- polümeraas. Komplementaarsusprintsiip. RNA ­ biopolümeer, mille monomeerideks on ribonukleotiidid Transkriptsioon: Süntees, mille käigus saadakse DNA ühe ahela nukleotiidse järjestusega

Bioloogia → Bioloogia
10 allalaadimist
thumbnail
2
doc

I KT kordamisküsimused - molekulaargeneetika põgiprotsessid

I kontrolltöö – molekulaarbioloogia põhiprotsessid 1. nimeta molekulaargeneetika põhiprotsessid Molekulaargeneetilised põhiprotsessid on DNA süntees e. replikatsioon, RNA süntees e. transkriptsioon ja valgu süntees e. translatsioon. 2. mis on replikatsioon? Millal ja milleks see toimub? Replikatsioon on DNA kahekordistamine enne raku jagunemist, millega tagatakse, et jagunemisel moodustunud tütarrakud saaksid täpselt sama päriliku info. 3. mis on transkriptsioon? translatsioon? Transkriptsioon on RNA süntees, mis toimub päristuumsetel organismidel rakutuumas. See on matriitsreaktsioon, mille käigus saadakse DNA ühe ahela nukleotiidsele

Bioloogia → Bioloogia
3 allalaadimist
thumbnail
4
docx

Replikatsioon, transkriptsioon, translatsioon - Protsesside mõisted, toimumiskohad rakus, ensüümid, toimumiskäigud

1. Põhikursuses õpitud molekulaargeneetika kordavalt – replikatsioon, transkriptsioon, translatsioon. Nende protsesside mõisted, toimumiskohad rakus, ensüümid, toimumiskäigud. (vt esitlusi Translatsioon ja Transkriptsioon) REPLIKATSIOON- kromosoomide koostisaine DNA kahekordistumine. Saadakse ühest DNA molekulist kaks identse järjestusega DNA molekuli. (protsess eelneb raku jagunemisele nt mitoosile). Viib läbi ensüüm DNA-polümeraas. ● TOIMUB: eeltuumsetel tsütoplasmas; päristuumsetel rakutuumas, mitokondrites, kloroplastides. ● KOMPLEMENTAARSUS: A=T; G=C ● DNA-polümeraas keerab DNA biheeliksi järk-järgult lahti ja kummagi esialgse ahela

Bioloogia → Biotehnoloogia
5 allalaadimist
thumbnail
1
rtf

Bioloogia mõisted ja nende seletused

Geneetika - Teadusharu, mis uurib organismide pärilikkuse ja muutlikkuse seaduspärasusi. Geneetiline kood - mRNA molekuli kolme järjestikuse nukleotiidi vastavus ühele aminohappejäägile valgu molekulis. Genoom - Liigiomases ühekordses kromosoomikomplektis sisalduv geneetiline materjal. Inimese genoom koosneb 24 kromosoomist. Genotüüp - Isendile omane geenide ja selle erivormide (alleelide) kogum. Initsiaatorkoodon - mRNA nukleotiidne järjestus AUG, millest algab translatsioon. Initsiaator-tRNA - tRNA molekul, mis seostub initsiaatorkoodoniga ja alustab valgusünteesi. Koodon - mRNA molekuli kolm järjestikust nukleotiidi, mis vastavad ühele aminohappele valgu molekulis. Promootor - DNA nukleotiidne järjestus, millega transkriptsiooni läbiviiv ensüüm (RNA- polümeraas) peab sünteesi alustamiseks ühinema. Regulaatorgeen - Geen, mille alusel sünteesitud valgud kontrollivad struktuurgeenide avaldumist

Bioloogia → Bioloogia
3 allalaadimist
thumbnail
8
docx

Mikrobioloogia kordamisküsimused 3 osa

olevad DNA fragmendid, et viia süntees lõpuni  Tütarmolekulide lahknemine saab valmis 3. Transkriptsioon 1. RNA polümeraas seostub geenist ülal asuva promootoralaga. 2. RNA polümeraas lisab komplementaarseid nukleotiide märklaud DNA segmendile 5’ - 3’ direction. 3. Uratsiil on adeniinile komplementaarne. 4. Terminatsioonil, RNA polümeraas tunneb ära signaali ja transkript vabaneb. 5. 100-1200 nukleotiidi pikk. 4. Translatsioon  Ribosoomid seonduvad mRNA transkripti 5’ otsa  Ribosoomid skanneerivad mRNAd kuni start-koodonini (tavaliselt AUG)  tRNA molekuli komplementaarse antikodooni ning metioniini aminohappega siseneb ribosoomi P-alasse ning seondub mRNAle. 5. Geneetiline kood ja antikodoon Geneetiline kood  Geneetilise koodi määravad mRNA kodoonid ja neile vastavad aminohapped  Kood on universalne  Kuna ühte aminohapet määrab mitu koodonit, ei ole proteiini struktuuri

Bioloogia → Mikrobioloogia
12 allalaadimist
thumbnail
7
doc

Nimetu

MOLEKULAARBIOLOOGIA. 1. Missugusi geneetiliseinfovahetuse protsesse tähistavad 1) transformatsioon, 2) transkriptsioon 3) translatsioon. Transkripitsioon ­ RNA molekuli sünteesimine vastava DNA molekuli pealt RNA-polümeraasi abil. Translatsioon ­ valgu sünteesimine vastava mRNA molekuli pealt, toimub ribosoomide abil. Transformatsioon ­ pärilik muutus eukarüootse raku omadustes (geneetilise info kadndumine ühest bakterirakust teise, rakust isoleeritud DNA abil). 2. Mis on TBP funktsioon initisiatsiooni kompleksi tekkes? TBP ­ TATA Binding Protein TBP seondub DNA TATA-box saidi külge painutades DNA molekuli nurga alla 3. Kas transkriptsioonifaktorid (aktivaatorid) interakteeruvad otse

Varia → Kategoriseerimata
29 allalaadimist
thumbnail
2
doc

PÄRILIKKUS

Kordamisküsimused 11. klassile ­ VI 1. nimeta molekulaargeneetika põhiprotsessid DNA süntees e. Replikatsioon RNA süntees e transkriptsioon valgu süntees e translatsioon 2. mis on replikatsioon? Millal ja milleks see toimub? Replikatsioon on matriitssüntees, mille tulemusena saadakse ühest DNA molekulist kaks ühesuguse nukleotiidse järjestusega DNA molekuli.Replikatsioon toimub iga kord enne raku jagunemist ­ see leiab aset nii mitoosi ­ kui ka meioosieelselt kõigis päristuumsetes organismides. Replikatsioon tagab rakujagunemise käigus päriliku info võrdse ülekande lähterakust tütarrakkudesse. 3. mida nimetatakse geeniks?

Bioloogia → Bioloogia
92 allalaadimist
thumbnail
2
wps

Molekulaargeneetika - lühikokkuvõte

Pärilikkus GENEETIKA-teadusharu,mis uurib org. pärilikkuse ja muutlikkuse seaduspärasusi. GENOOM- liigiomases ühekordses kromosoomikomplektis sisalduv geneetiline materjal (inimese genoom koosneb 24kromooomist) GENOTÜÜP-ühele isendile omane geenide ja selle erivormide kogum (nt.minu ainult) FENOTÜÜP- isendi vaadeldavate tunnuste kogum,mis tuleneb genotüübi ja keskkonnategurite koostoimest Molekulaargeneetika VALGUD- ENSÜÜMID- bikatalüsaatorid, TRANSPORTVALGUD-(membraanis, hemoglobiin), RETSEPTORVALGUD-(membraanis), HORMOONID-(nt.insuliin), ANTIKEHAD-(antigeenide v võõrmolekulide vastu), LIIKUMISVALGUD- (lihastel), EHITUSLIKUD VALGUD-(karvad..), (ENERGIA TOOTMISEKS) Molekulaargeneetika põhiprotsessid REPLIKATSIOON-DNA SÜNTEES(DNA matriitsi järgi) TRANSKRIPTSIOON-RNA SÜNTEES (DNA matriitsi järgi) TRANSLATSIOON-VALGUSÜNTEES (mRNA matriitsi järgi) GEEN- DNA lõik, mis määrab ühe RNA(promootor, RNA sünteesipiirkond, terminaator) mRNA seost...

Bioloogia → Bioloogia
131 allalaadimist
thumbnail
2
doc

Geneetika

BIOLOOGIA KONTROLLTÖÖ 3 MÕISTED GENEETIKA ­ Teadus pärilikkusest. MOLEKULAARGENEETIKA ­ Uurib pärilikkust, molekulide tasemel. PÄRILIKKUS ­ Looduse seaduspära, mille kohaselt järglased sarnanevad oma vanematega DNA ­ Pärilikkus aine, koosneb suhkrust, lämmastikalusest ja fosfaatrühmast. RNA ­ Koosneb suhkrust, lämmastikalusest ja fosfaatrühmast. GEEN ­ DNA lõik , mis määrab ära tunnuse. GENOTÜÜP ­ Organismi kõigi geenide kogu ühes rakus. FENOTÜÜP ­ Organismi kõik tunnused. (silmavärvus, pikkus) KROMOSOOID ­ Kokkupakitud DNA RETSESSIIVNE ALLEEL ­ Määrab tunnuse ainult siis, kui kromosoomi täh. "a" Paaris on ühesugused alleelid. DOMINANTNE ALLEEL ­ Määrab alati organismi tunnuse. Täh. "A" HOMOSÜGOOTSUS ­ Kromosoomi paaris on ühesugused alleelid HETEROSÜGOOTSUS ­ Kromosoomi paaris on erinevad alleelid MENDELI I SEADUS ­ Homosügootsele vanemate ristamisel on kõik järglased identsed. MENDELI II SEADUS ­ Heterosügootsete vanemate...

Bioloogia → Bioloogia
25 allalaadimist
thumbnail
8
doc

Molekulaarbioloogia teise KT vastused

Funktsioonid: transkriptsiooni/replikatsiooni domäänide definitsioon; ex. betaglobiini (LCR) SCS/SCS' mudeli süsteemid Drosophila Heat Shock Locus-s; reguleerib transkriptsiooni, kromatiini struktuuri, geeni ekspressiooni. Need elemendid moodustavad DNA pidepunkti kromatiini tellingute jaoks ja sobivad, selleks et oragniseerida kromatiin struktuurseteks domäänideks. 34. Eukarüootse mRNA molekuliga toimuvad muutusi pärast transkriptsiooni lõppu. Eukarüootides sünteesitakse mRNA tuumas, translatsioon toimub aga tsütoplasmas, seega on transkriptsioon ja translatsioon ruumiliselt lahutatud. Eukarüootne mRNA läbib reeglina enne tsütoplasmasse jõudmist "protsessingu", mille käigus primaarsest transkriptist eraldatakse intronid ja lisatakse 5' otsa cap struktuur ning 3' otsa lisatakse poly(A) järjestus. Peale protsessingut transporditakse küps mRNA läbi tuumapooride tsütoplasmasse. Nii "cap" kui polü(A) on lisaks mRNA stabiilsusele ja transpordile vajalikud ka mRNA

Bioloogia → Molekulaar - ja rakubioloogia...
153 allalaadimist
thumbnail
10
docx

Molekulaar- ja rakubioloogia KT II

1 MOLEKULAAR- JA RAKUBIOLOOGIA | YTM0011 II KONTROLLTÖÖ KORDAMISKÜSIMUSED | MIHKEL HEINMAA TTÜ YAGB31 | 08/10/10 TRANSKRIPTSIOON JA GEENI REGULATSIOON 1. Missuguseid geneetilise infovahetuse protsesse tähistavad a) transformatsioon, 2) transkriptsioon 3) translatsioon. Transformatsioon on geneetilise info ülekandumine ühest bakterirakust teise rakust isoleeritud DNA abil. Transkriptsioon ehk RNA süntees on DNA ühe ahela (matriitsahel) alusel komplementaarse RNA ahela süntees. Translatsioon on mRNA põhjal ribosoomides valguahela süntees. 2. Võrdle transkriptsiooni initsiatsiooni protsesse prokarüootidel ja eukarüootidel.

Bioloogia → Molekulaar - ja rakubioloogia...
290 allalaadimist
thumbnail
2
odt

Valgusüntees

Pärilikkus ­ on looduse üldine seaduspärasus, mille kohaselt järglased sarnanevad oma vane- matega. Pärilikkuse uurimisega tegeleb geneetika. Muutlikus ­ organismide võime muutuda ja seeläbi erineda oma vanematest. Kromosoomid ­ rakutuumas pärilikkust kandvad kehakesed. Geen ­ kromosoomi lõik, mis määrab ühe või mitu pärilikku tunnust. Inimesel on keharakus 46 kromosoomi, millest 44 on autosoomid, mis ei osale soo määramisel ja 2 sugukromosoomi, mis osalevad soo määramisel( XX ­ naine, XY ­ mees ). Genoom ­ liigiomane, ühekordne kromosoomi komplekt. Koosneb 24 kromosoomist ­ 22 autosoomi ja 2 sugukromo-soomi. Genotüüp ­ issendi geenide ja nende erivormide ( ehk alleelide ) kogum. Fenotüüp ­ isendi vaadeldavate tunnuste kogum. Genotüüp + keskkonnategurid. Need kas pidurdavad või võimendavad tunnuste avaldumist. Molekulaargeneetika ­ on teadusharu, mis uurib pärilikkuse seaduspätasusi molekulaarsel alusel. 1)Replikatsioon ­ DNA kahekord...

Bioloogia → Bioloogia
160 allalaadimist
thumbnail
3
odt

Molekulaarbioloogia

1. Mõisted genoüüüp – organismi kõigi pärilike tegurite kogu ja koostoime fenotüüp – isendi avalduvate tunnuste kogum, mis kujuneb genotüübi ja keskkonna koostoimel. seosed nende vahel – Fenotüüp kujuneb genotüübi alusel, keskkonna mõjul. 2. DNA ehitus, komplementaarsusprintsiip. DNA ehitusüksused(monomeerid) on nukleotiidid(desoksüribonukleotiidid), mis on moodustunud suhkrust, desoksüriboosist, fosfaatrühmast ja lämmastikalusest. Fosfaatrühm ja desoksüriboosi jääk moodustavad DNA-ahela selgroo. Monomeerite erinevused tulenevad lämmastikalustest, milleks on adeniin, tsütosiin, guaniin ja tümiin. A=T (nende vahel 2 vesiniksidet) ja G=C (3 vesiniksidet) Vesinikside katkeb kergesti ja see on oluline DNA toimimisel. DNA nukleotiidide järjestus kannab organismi pärilikku teavet. 3. RNA ehitus. RNA ehk ribonukleiinhappe monomeerid on ribonukleotiidid. Need koosnevad lämmastikalusest, suhkrust ja fosfaatrühmast. RNAs on suhkruosaks riboos. Lä...

Bioloogia → Molekulaar - ja rakubioloogia...
23 allalaadimist
thumbnail
7
docx

Molekulaargeneetika alused ja viirused

Geeniteraapia---geneetiliste haiguste ravimeetod Geneetika---teadusharu, mis uurib organismide pärilikkuse ja muutlikkuse seaduspärasusi Geneetiline kood---mRNA molekul 3 järjestikuse nukleotiidi vastavus ühele aminohappe jäägile valgu molekulis Genoom--- Liigiomases ühekordses kromosoomikomplektis sisalduv geneetiline materjal. Genotüüp--- Ühele isendile omased geenid ja nende erivormide kogum. Initsiaatorkoodon---mRNA nukleotiidide järjestus AUG, millest algab translatsioon Initsiaator tRNA-tRNA molekul, mis seostub initsiaalkoodoniga ja alustab valgusünteesi Kapsiid--- viiruse genoomi ümbritsev valguline kate Koodipäike- Selle abil saab valkudes aminohape järjestuse paika seada kui on teada DNA või RNA järjestus. NB! KASUTAMISEKS PEAB OLEMA EES mRNA!!! Kui pole, siis tuleb see leida. Koodon--- mRNA molekuli 3 järjestikust nukleotiidi mis vastavad ühele aminohappele valgu molekulis

Bioloogia → Bioloogia
32 allalaadimist
thumbnail
1
doc

Mendeli II seadus

1. Mendeli II seadus Homosügootsete vanemate monohübriidsel ristamisel toimus genotüüpide lahknemine suhtes 1: 2: 1 ja fenotüüpide lahknemine suhtes 3: 1. Aa x Aa A a A AA Aa a Aa aa 2. Mõisted Monogeenne tunnus Polügeenne tunnus. Genotüüp- isendile omane geenide ja selle erivormide kogum. Fenotüüp- isendi vaadeldavate tunnuste kogum, mis tuleneb genotüübi ja keskkonnategurite koostoimest. Genofond- liigi/populatsiooni kõigi geenide ja nende alleelide e eriviormide kogum Homosügootsus- geenipaari seisund, mille puhul mõlemas homoloogilises kromosoomis paikneb vaadeldava tunnuse suhtes sama alleel. Heterosügootsus- geenipaari seisund, mille puhul homoloogilistes kromosoomides paiknevad vaadeldava tunnuse suhtes erinevad alleelid. Replikatsioon- Transkriptsioon- RNA süntees Translatsioon- valgu süntees Geneetiline kood- mRNA nukleotiidide triplettide vastavus aminohapete valgu molekulis. Om:universaalne, sünonüümne-ühele amin...

Bioloogia → Bioloogia
21 allalaadimist
thumbnail
2
pdf

XI klassi töö – biomolekulid

XI klassi töö – biomolekulid 1. Mille alusel eristatakse elus ja eluta loodust? Reasta eluslooduse organiseerituse tasemed. Elus ja eluta loodust eristatakse koostise (näiteks biomolekulid esinevad ainult elusorganismides) ning erinevate tunnuste alusel. Elusorganismidel on kindlad elu tunnused näiteks biomolekulide teke, aine- ja energiavahetus, paljunemine ja areng jne. Eluslooduse organiseerituse tasemed: Aatom - molekul - organell - rakk - kude - elund - elundkond - organism - liik - populatsioon - ökosüsteem - biosfäär 2. Milline element on orgaaniliste ühendite koostises tähtsaim? Orgaaniliste ühendite koostises on kõige olulisem element süsinik, sest orgaanilised ühendid on süsinikku sisaldavad ühendid. 3. Mis on süsivesikud ja mis on nende peamine roll eluslooduses? Süsivesikud on biomolekulid (orgaanilised ained), mis koosnevad süsinikust, vesinikust ja hapnikust. Süsive...

Varia → Kategoriseerimata
0 allalaadimist
thumbnail
2
doc

Kordamisküsimused: BIOLOOGIA

1.Nim. molekulaargeneetika põhiprotsessid. a)Replikatsioon b)Transkriptsioon c)Translatsioon 2.Mis on replikatsioon? Millal ja milleks see toimub? Replikatsioon-matriitssüntees,toimub iga kord enne raku jagunemist. Selle tulemusel saadakse DNA molekul. (Ühest-kaks ühesugust nukleotiidse järjestusega DNA molekuli). 3.Mis on transkriptsioon? translatsioon? a)Transkriptsioon: matriitssüntees. Toimub interfaasi ajal, saadakse RNA molekul. b)Translatsioon: matriitssüntees, saadakse valgu molekul. Toimib nii eel kui ka pristuumsetes rakkudes vastavalt vajadusele. 4.Mida nimetatakse geeniks? Geen: DNA lõik mis määrab ära ühe RNA molekuli sünteesi. 5.Millistest osadest koosneb geen? *Promootorist *RNA sünteesipiirkonnast *Terminaatorist 6.Mis on transkriptsiooni saadused? RNA molekulid 7.Mida nimetatakse geeni avaldumiseks?

Bioloogia → Bioloogia
24 allalaadimist
thumbnail
6
doc

Tööleht: pärilikkuse molekulaarsed alused

Metioniin, leutsiin, leutsiin, glutamiin, leutsiin, glütsiin. V On teada ühe DNA ahela nukleotiidjärjestus, leia teise ahela nukleotiidjärjestus (1p) DNA ahel: C-C-G-A-T-T-A-C-G-T DNA ahel: G-G-C-T-A-A-T-G-C-A VI Selgita järgmisi mõisteid: (7p) translatsioon, transkriptsioon, koodon, initsiaatorkoodon, terminaatorkoodon, aminohape, replikatsioon Translatsioon - valgu süntees, mis loob geneetilise koodi. Transkriptsioon - matriitssüntees, mille käigus saadakse DNA molekuli ühe ahela nukleotiidse järjestusega komplementaarne RNA molekul. Selle käigus saadakse mRNA, rRNA, tRNA molekulid. Koodon – ühele aminohppele vastav mRNA nukleotiidikolmik, koosneb kolmest erinevast nukleotiidist.

Bioloogia → Bioloogia
73 allalaadimist
thumbnail
1
odt

Bioloogia mõisted

sünteesitud ahel on komplementaarne vana ahelaga. RNA polümeraas ­ seondub DNA ahela promootorpiirkonnaga. Promootor ­ DNA nukleotiidne järjestus, millega transkriptsiooni läbiv ensüüm peab sünteesi alustamiseks ühinema. Terminaator ­ DNA nukleotiidne järjestus, mis lõpetab transkriptsiooni. Koodon ­ mRNA molekuli kolm järjestikust nukleotiidi, mis vastavad ühele aminohappele valgu molekulis. Initsiaatorkoodon ­ mRNA nukleotiidne järjestus AUG, millest algab translatsioon. Stoppkoodon ­ mRNA nukleotiidne järjestus , (UGA, UAA, UAG, mis lõpetab translatsiooni. Repressor ­ Regulaatorvalk, mis takistab transkriptsiooni läbi viiva ensüümi (RNA polümeraasi) seostumist promootorpiirkonnaga. DNA) A-T T-A G-C C-G RNA) A-U T-A G-C C-G

Bioloogia → Bioloogia
15 allalaadimist
thumbnail
2
doc

Molekulaargeneetika alused

Replikatsioon on matriitssüntees, mille tulemusena saadakse ühest DNA molekulist kaks ühesuguse nukleotiidse järjestusega DNA molekuli. See tagab rakujagunemise käigus päriliku info võrdse ülekande lähterakust tütarrakkudesse. 8. Mis on transkriptsioon? Transkriptsioon on matriitssüntees, mille käigus saadakse DNA molekuli ühe ahela nukleotiidse järjestusega komplementaarne RNA molekul. Selle käigus saadakse mRNA, rRNA, tRNA molekulid. 9. Mis on translatsioon? Translatsioon on valgu süntees, mis loob geneetilise koodi. 10. Kuidas saada DNA ühe ahela nukleotiidse järjestuse alusel teise DNA ahela nukleotiidne järjestus? A-T G-C 11. Kuidas saada DNA ühe ahela nukleotiidse järjestuse alusel RNA molekuli nukleotiidne järjestus? A-U G-C 12. Kirjelda replikatsiooni etappe. (Kasuta kindlasti mõisteid: DNA biheeliks; DNA-polümeraas; ensüüm; komplementaarne; nukleotiid; tütarahel)

Bioloogia → Bioloogia
149 allalaadimist
thumbnail
2
docx

Molekulaargeneetika ja viirused

1. Nimeta molekulaargeneetika põhiprotsessid · DNA süntees ehk replikatsioon · RNA süntees ehk transkriptsioon · Valgu süntees ehk translatsioon 2. Mis on replikatsioon? Millal ja milleks see toimub? Replikatsioon on matriitssüntees, mille tulemusena saadakse DNA molekulist kaks ühesuguse nukleotiidide järjestusega DNA molekuli. Toimub iga kord enne raku jagunemist. Toimub kõigis organismides. 3. Mis on transkriptsioon? Translatsioon? RNA süntees, DNA alusel/ matriitssüntees, mille käigus saadakse DNa molekuli ühe ahela nukleotiidse järjestusega kompementaarne RNA molekul. 4. Mina nimetatakse geeniks? Geen on DNA lõik, mis määrab ära ühe RNa molekuli sünteesi. 5. Millistest osadest koosneb geen? Geeni osad- promootor , RNA, sünteesipiirkond ,terminaator (ilma naljata). 6. Mis on transkriptsiooni saadused? mRNA, rRNa ja tRNA molekulid 7. Mida nimetatakse geeni avaldumiseks?

Bioloogia → Geneetika
31 allalaadimist
thumbnail
1
doc

Molekulaargeneetika

tasandil. Pärilikkus- eluslooduse üldine seaduspärasus, mille kohaselt järglased sarnanevad ehituselt ja talitluselt vanematega. 2. Geenist saab tunnus : DNA - > mRNA - > valk. 3. Transkriptsioon ehk RNA süntees. Toimub rakutuumas interfaasi ajal. Ühe DNA lõigu järgi moodustatakse RNA. Tekivad mRNA, tRNA, rRNA. Lähteained on RNA polümeraas, mis keerab lahti ja sünteesib. 4. Translatsioon ehk valgu süntees. Toimub ribosoomides. Lähteained : aminohapped, tRNA molekule, ensüümid ja energiaallikatena ATP-d ja GTP-d. Tekib : valk. 5. Geneetiline kood ­ mRNA molekuli kolme järjestikkuse nukleotiidi vastavus ühele aminohappejäägile valgu molekulis. Koodon ­ mRNA molekuli kolm järjestikkust nukleotiidi. Antikoodon ­ kolm järjestikkust nukleotiidi transportkoostises.

Bioloogia → Bioloogia
35 allalaadimist
thumbnail
1
doc

Geneetiline kood

RNA sünteesitakse komplementaarsuse alusel.Transkriptsiooni viib läbi ensüüm RNA- polümeraas, mis seostub promootoriga. Vabaneb terminaatori polümeraas, RNA on valmis. 6. Kuidas toimub DNA-süntees? (replikatsioon) DNA süntees on DNA kahekordistamineraku jagunemise eel. Protsessi teostab ensüüm DNA-polümeraas. Replikatsiooni tulemusena tekib ühest DNA molekulist 2 identset DNA molekuli. 7. Kuidas toimub valgu süntees? (translatsioon) Toimub ribisoomis. Osalevad mRNA, tRNA ja rRNA. Translatsioon algab alguskoodoniga AUG. Lõpeb stoppkoodonitega. 8. Miks on geneetiline kood ühetähenduslik? Alati määrab kindla aminohappe ära üks koodon – üksühene vastavus. 9. Miks on geneetiline kood mittekattuv? Ükski mRNA nukleotiid ei kuulu samaaegselt kahe kõrvuti asetseva koodoni koostisesse. 10. Missugust geneetilise koodi nähtust nimetatakse sünonüümsuseks? Nähtus, mil ühele aminohappele vastab mitu koodonit.

Bioloogia → Bioloogia
43 allalaadimist
thumbnail
1
rtf

Pärilikkuse molekulaarsed alused ja viirused

geneetiline kood ­ keemiliste juhiste süsteem, mille alusel geneetilisest infost luuakse mRNA vahendusel proteiine / mRNA molekuli kolme järjestikuse nukleotiidi vastavus ühele aminohappejäägile valgu molekulis. koodon ­ 3 järjestikust mRNA nukeotiidi. 1 koodon määrab 1 kindla aminohappe. antikoodon ­ tRNA molekuli kolmenukleotiidne järjestus, mis seaostub valgusünteesi käigus mRNA koodoniga. initsiaatorkoodon ­ mRNA nukleotiidne järjestus AUG, millest algab translatsioon. stoppkoodon ­ mRNA nukleotiidne järjestus (UGA; UAA; UAG), mis lõpetab translatsiooni. polüsoom ­ ühe mRNA molekuliga seotud ribosoomide kogum, milles sünteesitakse sama aminohappelise järjestusega valke. bakteriofaag ­ viirus, mille peremeesrakuks on bakter. struktuurgeen ­ viirusvalkude süntees. replikatsioonigeen ­ viiruse genoomi paljundamine. regulaatorgeen ­ peremeesraku aktiivsuse mõjutamine viirusele soodsaks.

Bioloogia → Bioloogia
77 allalaadimist
thumbnail
4
doc

Tööleht: Pärilikkuse molekulaarsed alused

RNA ahel: Valgufragment: V On teada ühe DNA ahela nukleotiidjärjestus, leia teise ahela nukleotiidjärjestus (1p) DNA ahel: C-C-G-A-T-T-A-C-G-T VI Selgita järgmisi mõisteid: (7p) translatsioon, transkriptsioon, koodon, initsiaatorkoodon, terminaatorkoodon, aminohape, replikatsioon VII Pane järgnevad protsessid ja nende tulemused õigesse järjekorda: (3p) RNA, replikatsioon, transkriptsioon, DNA, valk, translatsioon. VIII Leia tulpadest sobivad vasted ja ühenda need joontega. (4p) Geneetilise koodi omadused

Bioloogia → Bioloogia
61 allalaadimist
thumbnail
3
odt

tööleht pärilikkus

TACACGAAGATGTCGATCCTATTC RNA ahel: AUGUGCUUCUACAGCUAGGAUAAG Valgufragment IV Pane järgnevad protsessid ja nende tulemused õigesse järjekorda: RNA, replikatsioon, transkriptsioon, DNA, valk, translatsioon. 1.DNA ;2.Transkriptsioon ;3.valk, 4.RNA, 5.translatsioon V Leia tulpadest sobivad vasted, kirjuta selgituse lõppu omaduse nr Geneetilise koodi omadused 1. Sünonüümsus Ühesugune koodonite ja aminohapete vastavus eksisteerib peaaegu kõigis pro- ja eukarüootides 3 2. Ühetähenduslikkus Ühele aminohappele vastab mitu koodonit 1 3

Bioloogia → Bioloogia
2 allalaadimist
thumbnail
2
doc

Pärilikkus

· Pärilikkus-organismide võime taas toota enda sarnaseid järglasi · Geneetika- teadusharu, mis uurib organismide pärilikkust ja muutlikkust. · Pärandumine- geneetilise info säilitamine ja edastamine mitoosi ja meioosi teel · Geen- pärilikkuse elementaarüksus, üks DNA lõik, mis annab edasi ühe või mitu tunnust · Genoom- geenide kogum · Genotüüp- geenide kogu organismide sees · Fenotüüp- tunnuste kogu(väliste) Pärilikkuse molekulaar geneetilised alused Molekulaar geneetika on teadus, mis uurib pärilikkuse seaduspärasusi molekulaarsel tasandil. Jaguneb 3 protsessi: 1) Replikatsioon ehk DNA süntees 2) transkripsioon ehk RNA süntees 3) Transulatsioon ehk valgu süntees REPLIKATSIOON Ühest DNA molekulist saadakse kaks ühesuguse nukleoliitse järjestusega DNA molekuli On Vaja: organismi rakke, ensüüme, DNA lõiku, toimumiskohta(rakutuum) Tekib kaks ühesuguse nukleotiidse koostisega DNA mo...

Bioloogia → Bioloogia
46 allalaadimist
thumbnail
2
odt

Molekulaargeneetika ja viirused

promootoriks. DNA biheeliks keeratakse järk-järgult lahti ning sünteesitakse ühe ahela teatava lõiguga komplementaarne RNA molekul. RNA süntees lõpeb, kui ensüüm jõuab DNA nukleotiidse järjestuseni, mida nimetatakse terminaatoriks. Transkriptsiooni tulemusel saadakse mRNA, rRNA kui ka tRNA molekulid. 4. Ülesanne: DNA molekuli järgi RNA molekuli moodustamine. TG / C G T T A C C A T A G T A T T/ A DNA G C AA U G G U A U C A U AA RNA 5. Mis on translatsioon,kus toimub,lähteained,mis toimub, mis tekib? Translatsioon- ehk valgusüntees. Toimub raku tsütoplasmas asuvates ribosoomides. Protsessi toimumiseks on lisaks mRNA molekulidele vaja veel erinevaid tRNA molekule, aminohappeid, ensüüme ja energiaallikana ATP-d ja GTP-d. See algab mRNA ühinemisest ribosoomiga. Valgu süntees algab alati initsiaator koodonist. mRNA initsiaatorkoodoniga seostub esimene tRNA molekul. tRNA-d toovad kohale aminohapped. Aminohappe määrab antikoodon-koodon vastavus

Bioloogia → Bioloogia
29 allalaadimist
thumbnail
3
doc

Molekulaargeneetika ja viirused

BIOLOOGIA: Molekulaargeneetika ja viirused Geen- DNA lõik, mis määrab ära ühe RNA molekuli sünteesi. Geneetika- teadusharu, mis uurib pärilikkuse ja muutlikuse seaduspärasusi. Genotüüp- ühele isendile omaste geenide ja nende erivormide kogum. Fenotüüp- ühe isendi vaadeldavate tunnuste kogum. Genoom- liigiomases ühekordses kromosoomikomplektis sisalduvat geneetilist materjali nimetatakse genoomiks. Genoom on omane liigile. Molekulaargeneetika- teadusharu, mis uurib pärlilikkuse ja muutlikuse seaduspärasusi molekulaarsel tasemel. Pärilikkus- looduse üldist seaduspärasust, mille kohaselt järglased sarnanevad ehituselt ja talitluselt vanematega nimetatakse pärilikkuseks. Transkriptsioon- matriitssüntees, mille käigus saadakse DNA molekuli ühe ahela nukleotiidse järjestusega komplementaarne RNA molekul. Protsess toimub rakutuumas interfaasi ajal. Seda viib läbi ensüüm, mis transkriptsiooni alustamiseks peab seostuma vastava geeni alguso...

Bioloogia → Bioloogia
91 allalaadimist
thumbnail
1
docx

Geneetika kordamisküsimuste vastused

1. geneetika - bioloogia haru, mis uurib pärilikkuse ja muutlikkuse seaduspärasusi 2. geen - DNA molekuli lõik 3. genoom - liigiomases ühekordses kromosoomikomplektis sisalduv geneetiline materjal 4. genotüüp - organismi kõigi pärilike tegurite kogu ja koostoime 5. DNA replikatsioon - protsess, mille käigus kopeeritakse DNA molekul 6. transkriptsioon - protsess, mille käigus DNAs paikneva info põhjal sünteesitakse RNA-ahel 7. translatsioon - valkude sünteesimine ehk aminohappeahela koostamine vastavalt mRNAs olevatele juhistele 8. promootor - geeni algusosa 9. terminaator - geeni lõpuosa 10. geneetiline kood - seaduspära, mille järgi mRNA nukleotiidkolmikutele vastavad aminohapped 11. koodon - ühele aminohappele vastav mRNA nukleotiidikolmik 12. antikoodon . mRNA koodoniga komplementaarne koodon tRNAs, mis tagab õige aminohappe jõudmise ribosoomi 13. initsiaatorkoodon - algusosa, algab valgussüntees 14

Bioloogia → Geneetika
5 allalaadimist
thumbnail
6
rtf

Molekulaarbioloogilised põhiprotsessid

(C) ja guaniin (G). Pärilik info tulenebki nende nelja monomeeride järjestusest – millised nukleotiidid millises järjekorras on DNA molekulis. Molekulaargeneetika on teadusharu, mis uurib pärilikkusega seotud protsesse molekulaarsel tasemel. Mitmete molekulaargeneetiliste protsesside seas eristatakse kolme universaalset põhiprotsessi: o DNA süntees e. replikatsioon, o RNA süntees e. transkriptsioon, o valgu süntees e. translatsioon. Molekulaargeneetika uurib molekulaarsel tasemel, kuidas ja millal DNA molekulides paiknev pärilik info avaldub konkreetsetes tunnustes. Replikatsioon on DNA kahekordistumise protsess, mis toimub enne rakkude jagunemist. Sellega tagatakse, et pooldumisel (mitoosil) moodustunud tütarrakud saaksid täpselt sama päriliku info. Üldistatult võime öelda, et indiviidi pärilikud tunnused kujunevad paljude valkude koostoime tulemusena. Valgud on biopolümeerid, mille monomeerideks on aminohapped

Bioloogia → Molekulaarbioloogia
3 allalaadimist
thumbnail
5
doc

Pärilikkus

8. Geneetiline kood ­ mRNA molekuli kolme järjestikuse nukleotiidi vastavus ühele aminohappejäägile valgumolekulis. 9. Genoom ­ liigiomases ühekordses kromosoomikomplektis sisalduv geneetiline materjal. Inimese genoom koosneb 24 kromosoomist. 10. Genotüüp ­ isendile omane geenide ja selle erivormide (alleelide) kogum. 11. Initsiaatorkoodon ­ mRNA nukleotiidne järjestus, AUG, millest algab translatsioon. 12. ­''- tRNA ­ tRNA molekul, mis seostub initsiaatorkoodoniga ja alustab valgusünteesi. 13. Kapsiid ­ viiruse genoomi ümbritseb valguline kate. 14. Koodon ­ mRNA molekuli 3 järjestikust nukleotiidi, mis vastavad ühele aminohappele valgumolekulis. 15. Lüsogeenne tsükkel ­ viiruste paljunemisviis, mille korral peremeesraku kromosoomiga seostunud viiruse genoom kohaselt ei avaldu, vaid kandub koos rakujagunemisega uutesse tütarrakkudesse. 16

Bioloogia → Bioloogia
131 allalaadimist
thumbnail
2
docx

Bioloogia mõisted geneetika teemast

Replikatsioon ­ DNA ahela kahekordistumine enne raku jagunemist Replikatsioon toimub seal, kus on DNA(tuumas, tuumapiirkonnas, kloroplastides) Replikatsiooni tulemuseks on 2 uut identset DNA ahelat Replikatisooni tähtsuseks on see, et iga rakk saab ,,eeskirja", kuidas endale valke toota Transkriptsioon ­ on DNA ühe ahela alusel komplementaarse RNA molekuli süntees Transkriptsioon toimub seal, kus on DNA(tuumas, tuumapiirkonnas, kloroplastides) Transkriptsiooni tulemuseks on 3 erinevat vormi RNAd: rRna; mRNA; tRNA Transkriptsiooni tähtsuseks on see, et tekivad 3 vormi RNAd, mis aitavad uusi valke toota Translatsioon ­ RNA alusel valgu süntees tsütoplasmas paiknevatel ribosoomidel: RNAlt valk Translatsioon toimub tüstoplasmas ribosoomidel Translatsiooni tulemuseks on uus valk? Translatsiooni tähtsuseks on uute valkude teke Sarnasused: transk. ja replik. eelduseks on 1 DNA ahel Erinevused: transk. tekib 3 vormi RNAd; replik. tekib 2 i...

Bioloogia → Geneetika
1 allalaadimist
thumbnail
3
docx

BIOLOOGIA KONTROLLTÖÖ - MOLEKULAARGENEETIKA

BIOLOOGIA KT MOLEKULAARGENEETIKA MÕISTED Geneetika ­ bioloogia haru, mis uurib pärilikkust, geenide struktuuri ja funktsioone. Geen ­ pärilikkuse tegur, mis antakse nt vanemalt edasi Genoom ­ liigiomases ühekordses kromosoomikomplektis sisalduv geneetiline materjal DNA replikatsioon ­ 1 DNA molekulist 2 ühesugugust DNA molekuli Transkriptsioon ­ sünteesitakse DNA molekulist RNA molekul Translatsioon - päriliku info avaldumine, valkude süntees Promootor ­geeni alguses asuv piirkond, RNA-polümeraas peab transkriptsiooni alustamiseks seonduma Terminaator ­ Geneetiline kood ­ seaduspära, mille järgi mRNA nukleotiidikolmikutele vastavad aminohapped Koodon ­ ühele aminohappele vastav mRNA molekuli nukleotiidikolmik geneetilises koodis Antikoodon ­ mRNA koodoniga komplementaarne koodon tRNA-s, tagab õige aminohappe jõudmise ribosoomi Initsiaatorkoodon ­ mRNA algusosa Stoppkoodon ­ mRNA lõpposa, millel lõpeb valgu...

Bioloogia → Bioloogia
40 allalaadimist
thumbnail
3
pdf

Molekulaargeneetika põhiprotsessid

Molekulaargeneetika põhiprotsessid Kõiki neid protsesse nimetatakse ​matriitsünteesideks​. See tähendab, et uued molekulid toodetakse olemasolevate molekulide järgi. 1. Replikatsioon ​- DNA tootmine DNA järgi 2. Transkriptsioon ​- RNA tootmine DNA järgi 3. Translatsioon -​ Valgu molekuli tootmine mRNA järgi DNA replikatsioon - Toimub rakutuumas enne jagunemist - Vaja on: - Ensüüme (DNA polümeraas) - Vabasid DNA nukleotiide (6 miljardit) - Energiarikkaid ühendeid (ATP jt.) - Toimub vastavalt komplementaarsusele (G​≡​C, A=T) - Vaata pilti õpik lk. 17 → AATTGGCC → AATTGGCC Algne → TTAACCGG → Kaks identset DNA

Bioloogia → Molekulaarbioloogia
6 allalaadimist
thumbnail
4
doc

Geneetiline kood ja valgu süntees

Kasutatakse ATP või GTP keemilist energiat. Osalevad tsütoplasma valgulised pikendamisfaktorid. · Terminatsioon ­ leiab aset kui jõutakse ,,stopp" koodonini, vabaneb polüpeptiidahel ­ valk. Osalevad tsütoplasma vabastusfaktorid. 11. Eükarüootsetes organismides kodeerib üks mRNA ühe valgu sünteesi, prokarüootsetes aga mitut valku. Prokarüootides ei toimu mRNA modifitseerimist ja translatsioon ning transkriptsioon mõlemad toimuvad tsütoplasmas. Eükarüootidel toimub transkriptsioon tuumas, translatsioon ribossomis. 12. Eükarüootidel toimub transkriptsioon tsütoplasmas, translatsioon ribossomis. Enne peab transkriptsioon tuumas lõppema ja mRNA tuleb toimetada ribosoomi, et saaks alata translatsioon. 13. Valkude post-translatsiooniline modifitseerimine: · Valkude kokku pakkimine · Biokeemiline modifitseerimine · Translokatsioon erinevatesse raku organellidesse

Keemia → Biokeemia
208 allalaadimist
thumbnail
2
doc

Pärilikkus

promootorpiirkonnaga Antikoodon ­ tRNA molekuli kolmenukleotiidne järjestus, mis seostub valgusünteesi käigus mRNA koodoniga Fenotüüp ­ ühe organismi tunnuste kogum Geen ­ kromosoomi lõik, mis määrab 1 valgu molekuli sünteesi (mRNA sünteesi) Geneetika ­ teadus, pärilikkusest ja muutlikkusest Genotüüp ­ ühe organismi geenide kogum Initsiaatorkoodon ­ mRNA nukleotiidne järjestus AUG, millest algab translatsioon Molekulaargeneetika ­ teadus pärilikkuse uurimisest molekuli tasandil Muutlikkus ­ organismide võime omandada uusi tunnuseid Polüsoom ­ ühe mRNA molekuliga seotud ribosoomide kogum, mis sünteesivad sama aminohappelise järjestusega valke Promootor ­ DNA nukleotiidne järjestus, millega transkriptsiooni läbiviiv ensüüm peab sünteesi alustamiseks ühinema Pärilikkusorganismide võime säilitada vanemate tunnused ja anda neid järglastele Repressor ­

Bioloogia → Bioloogia
390 allalaadimist
thumbnail
6
docx

Bioloogia eksami materjal

Agrobacterium tumefaciens (bakter). Sisestatud geene kutsutakse transgeenideks. Kalkooni süntaas on ensüüm, mis on oluline antotsüaanide biosünteetilise raja alguses. Fenomen, kus mõlemad geenid (transgeen ja oma geen) on vaigistatud, nimetatakse `koos- allasurumiseks. Translatsioon- RNA ahelast saadakse geneetilise koodi kaudu valgu aminohappeline järjestus. Toimub ribosoomidel. mRNA- RNA molekul, kus toimub translatsioon geneetiline kood- 1 koodon (3 nukleotiidi) kodeerib 1 hapet. Olemas on 20 aminohapet. START koodon- AUG,(metioniin) tähistab translatsiooni algust, ilma selleta translatsiooni ei toimuks. STOP koodon- UGA, UAA, UAG. Tähistavad translatsiooni lõppu. Aminohape koosneb amiingrupist (NH2) ja karboksüülrühmast (COOH) Asendamatud aminohapped peab inimene saama toiduga. Ribosoom: organell tsütoplasmas, kus toimub valgu süntees (translatsioon).

Bioloogia → Bioloogia
6 allalaadimist


Sellel veebilehel kasutatakse küpsiseid. Kasutamist jätkates nõustute küpsiste ja veebilehe üldtingimustega Nõustun