1. (a) (i) gene length of DNA; codes for a (specific), polypeptide / protein / RNA; max 1 allele alternative form of a gene; found at a, locus / particular position on, a chromosome; max 1 (ii) assume allele refers to coat colour allele (coat colour) gene / alleles, only on X chromosome; A no (coat colour), gene / allele, on Y chromosome male cats, XY / only have one X chromosome; males have only one (coat colour) allele / cannot have two (coat colour) alleles; need black and orange alleles for tortoiseshell colour; 2 r r w w (b) parental genotypes C C × C C ; r w
CACCCGCGCCCGCCGGGTCCGCGTTCCAGCGCGTGCCTAGCAGTCCGCGCCTGGGGCCGG GCGCTCACCGGACTTCGGAGGGTAGCGATAGGCCGAGTTCGCCTGGATGTCGATGTCCTC CACCCCCGCGATGCGGCGGCTGAGAATGGAGCCCATGGTGCGCCGCGCTGCCGGGCAGAG GGGCCAGGGCCGGAACGGGAGCGGCGACAGCGGCGGGGTCCTCA Rohelised ja allakriipsutatud on Cfr421 saidid. Kollane "highlight" on inserdi järjestus. DNA järjestuse võrdlemine andmepankades olevate tuntud järjestusega kasutades BLAST. >emb|AL359092.14| Human DNA sequence from clone RP11-57C19 on chromosome 9 Contains the 3' end of the FUBP3 gene for far upstream element (FUSE) binding protein 3, an ribosomal protein L19 (RPL19) pseudogene, the PRDM12 gene for PR domain containing 12, the gene for RRP4 (homolog of yeast RRP4 (ribosomal RNA processing 4) 3'-5' exoribonuclease), the 5' end of two variants of the ABL1 gene for v-abl Abelson murine leukemia viral oncogene homolog 1, a ribosomal protein L37 (RPL37) pseudogene and three CpG islands, complete sequence Length=173463
by pairing of neohaplonts for commercial cultivation. In: IMC7 Book of Abstracts. Oslo. 264. Saville, B.J., Kohli, Y. & Anderson, J.B. 1998. mtDNA recombination in a natural population. Proceedings of the National Academy of Sciences, USA 95: 1331-1335. Schardl, C.L. & Craven, K.D. 2003. Interspecific hybridization in plant-associated fungi and oomycetes: a review. Molecular Ecology 12: 2861–2873.lishing Zolan, M.E. 1995. Chromosome-length polymorphism in fungi. Microbiological Reviews, 49: 686–698. Tamm, H. 2004. Seeneperekonna Peziza (Pezizales, Ascomycota) gruppide P. varia ja P. violacea ning lähedaste liikide fülogeneetiline analüüs rDNA ITS regiooni alusel. Bakalaureusetöö. Tartu Ülikool. Käsikiri. Tamm, H., Kullman, B. & Kullman, K. 2005. Fungal Genome Size Database. In: Programme and Book of Abstracts of XVI Symposium of Mycologists
174(6), 877885. http://doi.org/10.1086/670366 Guo, Z., Pan, R.-Y., & Qin, X.-Y. (2013). Potential Protection of Coeloglossum viride var. Bracteatum Extract against Oxidative Stress in Rat Cortical Neurons. Journal of Analytical Methods in Chemistry, 7. http://doi.org/10.1155/2013/326570 Hong, Y., Gao, Q., Luo, Y., Luo, J.-P., Zhang, Y., Yuan, Q., & Yang, Q.-E. (2016). Karyology of Aconitum subgenus Lycoctonum (Ranunculaceae) from China, with a report of the new base chromosome number x = 6 in the genus Aconitum. Nordic Journal of Botany, 34(4), 441454. http://doi.org/10.1111/njb.00957 Kapusci Nski, K. L., Farrell, J. M., Stehman, S. V, Boyer, G. L., Nilo, D., Fernand O, D., ... Kapuscinski, K. L. (2014). Selective herbivory by an invasive cyprinid, the rudd Scardinius erythrophthalmus. Freshwater Biology, 59, 23152327. http://doi.org/10.1111/fwb.12433 12
, Dopazo, J. & Ramon, D. 1990. Sequences of isopenicillin N synthetase genes suggest horizontal gene transfer from prokaryotes to eukaryotes. Proceedings of the Royal Society of London, B 241: 164-169. Race, H.L., Hermann, R.G. & Martin, W. 1999. Way have organelles retained genomes? Trends in Genetics 15: 364-370. Saville, B.J., Kohli, Y. & Anderson, J.B. 1998. mtDNA recombination in a natural population. Proceedings of the National Academy of Sciences, USA 95: 1331-1335. Zolan, M.E. 1995. Chromosome-length polymorphism in fungi. Microbiological Reviews 59: 686-698. Tamura, M., Watanabe, K., Mikami, Y., Yazawa, K. & Nishimura, K. 2001. Molecular characterization of new clinical isolates of Candida albicans and C. dubliniensis in Japan: analysis reveals a new genotype of C. albicans with group I intron. Journal of Clinical Microbiology 39: 4309-4315. Taylor, J.W., Jacobson, D.J. & Fischer, M.C. 1999. The evolution of asexual fungi: reproduction, speciation and classification. Annual
(2) DNA järjestuse võrdlemine andmepankades olevate tuntud järjestustega kasutades BLASTN, MEGABLAST, BLAST 2 sequences jt programme (http://www.ncbi.nlm.nih.gov/) (3) "CpG island"i identifitseerimine inimese kromosoomis (BLAT programm, http://genome.ucsc.edu/cgi-bin/hgBlat) 109 nukleotiidi CCGCGGGTCGGCGGGGAGGTTGGGCCCAGGGATAAAAGAACTGGGGCTGGTGGGGGGGA GGGGTTCCCGGCCTAGGGGAAGGGCTATGACAATGGAATGACAACCGCGG Homo sapiens chromosome 15 genomic scaffold, alternate assembly CHM1_1.0 Sequence ID: ref|NW_004078084.1|Length: 73034944Number of Matches: 1 Related Information Map Vieweraligned genomic context Range 1: 36420564 to 36420672 GenBank Graphics Score Expect Identities Gaps Strand
3. Kromosoomide haploidne, diploidne ja põhiarv haploid (monoploid) (ingl. Haploid, monoploid)- Organism või rakk, millel on vaid üks kromosoomikomplekt (n). diploid (ingl. Diploid)- Kahe kromosoomikomplektiga (2n) rakud või organismid. Kõrgemate taimede ja loomade somaatilised koed on algul kromosoomistiku poolest diploidsed, erinevalt haploidsetest (monoploidsetest) gameetidest. kromosoomide põhiarv (ingl. Chromosome basic number)- Liigiomaste kromosoomide ühekordne arv (x), milles on üks genoom. Loomadel on kromosoomide põhiarv üldiselt haploidse e. gameetse (n) arvuga (x=n). Polüploididel, peamiselt taimedel, võib haploidne kromosoomiarv ületada kaks või rohkem korda põhiarvu (x≠n). 4. Sugukromosoomid inimesel sugukromosoomid e. gonosoomid (ingl. Sex chromosomes)- Soo määramises osalevad kromosoomid, vastandatud autosoomidele. 5
beyond the edges of the nose leather so they have no nose-liner and have whitish fur at the bottom of the nose. There is a link to one of the Snowknight cats, Joschka, around 7 generations back, so his torbie dynasty continues. The common ancestor from Poland is Snowknight Destiny. Either Destiny or her brother Snowknight Derringer had a very colourful torbie male offspring, but the breeder had him neutered rather than test-mating him. This was carried over from Joschka, who had an extra Chromosome. Caroline Sharp’s torbie male Bogomir Tschudovich of Misinza aka Meli is black-and-white, with a big flame of red over and around his ears and no sex-linked red parentage. Because those cats don't have the inhibitor (silver) gene, they looked even more like tortie-tabbies. Michelangelo, a colourful torbie male (without silver) from Caroline Sharp's breeding line. While silver-and-gold has turned up in Siberians, a silver-TO-gold effect has turned up in
Niiskes keskkonnas on kromosoomid pehmed, kuid muutuvad kõvaks kohe peale kuivamist. Pehmed kromosoomid on väga elastsed, eriti kui neid on väga lühikest aega fikseeritud. Elastseid kromosoome on võimalik faaskontrastmikroskoobi all mitu korda pikemaks venitada nagu kummipaela. Niiskes keskkonnas läbi viidud kromosoomide pikendamist nimetatakse kromosoomide venitamiseks ehk sirutamiseks (chromosome stretching). Kõige lihtsam on kromosoome värvida tavavärvimise meetodil Giemsa värviga. Töötluse tulemusena kromosoomid ei vöödistu, vaid värvuvad ühtlaselt. Kõige rohkem kasutatakse Giemsa värvi, mille koostisesse kuuluvad happeline eosiin Y ning aluseline metüülsinine ja thaziinvärv azuur B. Värv muudab kromatiini lillakaspunaseks. Giemsa-kompleksil on üks negatiivne ja kaks positiivset langut.
Nendest H3 ja H4 moodustavad tetrameeri, millele omakorda kinnituvad kaks H2A-H2B dimeeri. Ümber histoonide oktameeri on keerdunud DNA. Nukleosoomide rida DNAl moodustab pärlikee struktuuri, so 10 nm fiiber. Järgmises etapis pakitakse nukleosoomid omavahel kokku, mille tulemusena moodustub 30 nm kromatiini fiiber. Nukleosoomide vahele jäävale DNA-le seondub histoon H1 ja toob nukleosoomid omavahel kokku. 30 nm fiiber kinnitub lingudena kromosoomi tugivalkudele (chromosome scaffold), tugivalkudega seonduvaid DNA piirkondi nim SAR-iks (scaffold associated region). 30 nm fiiber moodustab loop’e, mis on umbes 300 nm pikad. 300 nm fiibrid surutakse kokku tihedalt pakitud spiraaliks ning moodustub 700 nm fiiber. Ning 700 nm fiiber keritakse tihedalt kokku metafaasi kromosoomi kromatiidiks (1400 nm). 2 Kriitika – kas 30 nm fiibrid eksisteerivad ka in vivo? On mitmeid töid 30 nm fiibri
extracellular proteins and peptides to cell-surface receptors. These receptors activate intracel- lular signal transduction pathways that regulate specific transcription factors through a variety of mechanisms. · Transposoon - A segment of DNA that is capable of independently replicating itself and inserting the copy into a new position within the same or another chromosome or plasmid. Transposons act somewhat similarly to viruses and in humans are an underlying cause of hemophilia, certain cancers, and other diseases. In other organisms, they can become a permanent and even beneficial part of the genome, as in maize corn, where transposons account for half the genome, and certain bacteria, where genes for antibiotic resistance can spread by means of transposons. Also called jumping gene.
Kromosoome denatureeritakse BaOH lahusega, millele järgneb Giemsa värvivimine. 6.FISH ja tema variatsioonid - · : 1. (). 2. in situ (FISH). 3. FISH : + FISH; + FISH; + FISH (FICTION); · : 1. (Whole painting). 2. (CGH). 3. (). 4. : c (SKY); FISH (M - FISH, M - BAND). 1. Cod-FISH ( chromosome orientation and direction FISH) võimaldab määrata absoluutset 3`-5` orientatsiooni ja inversioone. 2. Q-FISH (kvantitatiivne FISH) · Põhiliselt telomeeride pikkuse tuvastamine · Kasutatakse telomeerispetsiifilisi PNA-si · Signaal kvantifitseeritakse digitaalselt (lahutusvõime ~ 200 bp.) 20 · Võimaldab võrrelda individuaalsete kromosoomide telomeeride pikkusi · Subtelomeersed deletsioonid nõrgamõistuslikuse sage põhjus
järgnevalt, individuaalne arenev munarakk ümbritsetakse folliikuliga c. Emasgonaadi e munasarja areng: Mülleri juha - emasel taandarenevad testosterooni puudumise tõttu, isasel moodustavad osa munandimanusest Milleks on oluline SRY? (mis juhtub kui see geen defektne) SRY on sugu determineeriv piirkind. Munasarjade areng toimub automaatselt, kui puudub SRY (sex-determining region of the Y chromosome) mõju - seda on vaja testiste välja kujunemiseks ja spetsiifilisuse säilitamiseks; mutatsioonid võivad põhjustada 46XY naist e Swyer'i sündroomi Mis on sekundaarne soo determinatsioon? protsess, mille käigus kujuneb emas-ja isassoole omane fenotüüp (vastavad suguorganid , rinnanäärmed, kehasuurus, häälepaelad, muskulatuur, karvakasv) tänu gonaadides (munandid, munasarjad) produtseeritud hormoonidele ja parakriinsetele faktoritele
lõike ja asukohta kromosoomis. Meetod kasutab hübridisatsiooni sondi, mis seondub ainult sellele kromosoomi osale, millel on väga kõrge samasuse aste. Sond on iseenesest lühike DNA jupp (100 500 ap), mis on denatureeritud üheahelaliseks ning seejärel markeeritud flurestseeruvate markeritega. Fluorestents mikroskoopia abil saab üles leida kromosoomi piirkonna, kuhu sond on seostunud. Cod-FISH: (chromosome orientation and direction FISH) määrab kromosoomi 3' 5' orientatsiooni ja inversioone (ümberpööratud jupp). Suuna annab C-rikka ahela telomeerses piirkonnas hübridiseerinud sond. Q-FISH: telomeeride pikkuse tuvastamine. Kasutatakse telomeerspetsiifilisi PNA'sid (peptiidsidemetega nukleiinhapped), võimaldab võrrelda individuaalsete telomeeride pikkusi. Subtelomeersed deletsioonid nõrgamõistuslikkuse sage põhjus. Q-FISH'i edasiarendus on Flow-
JOURNAL Submitted (21-MAR-2000) Celera Genomics, 45 West Gude Drive, Rockville, MD 20850, USA COMMENT REVIEWED REFSEQ: This record has been curated by FlyBase. This record is derived from an annotated genomic sequence (NT_033777). The reference sequence was derived from CG7069-RA. FEATURES Location/Qualifiers source 1..2693 /organism="Drosophila melanogaster" /mol_type="mRNA" /db_xref="taxon:7227" /chromosome="3R" gene 1..2693 /gene="CG7069" /locus_tag="Dmel_CG7069" /old_locus_tag="CG7069" /note="CG7069" /map="94A6-94A6" /db_xref="FLYBASE:FBgn0038952" /db_xref="GeneID:42621" CDS 351..2585 /gene="CG7069" /locus_tag="Dmel_CG7069" /old_locus_tag="CG7069" /note="CG7069 gene product from transcript CG7069-RA" /codon_start=1
[WWW] http://www.ncbi.nlm.nih.gov/pubmed/11534970?dopt=Abstract (09.2001) /Internetis/ 10. Etymology of Homosexuality [WWW] ttp://www.drama.uwaterloo.ca/Gross %20Indecency/homosexuality_word.shtml (2.10.2007) /Internetis/ 11. Frankowski, B. Sexual Orientation and Adolescents [WWW] http://aappolicy.aappublications.org/cgi/content/full/pediatrics;113/6/1827 (06.06.2004) /Internetis/ 12. Hamer, D.; Hu, S. A linkage between DNA markers on the X chromosome and male sexual orientation [WWW] http://www.ncbi.nlm.nih.gov/pubmed/8332896? ordinalpos=5&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVDocSum (16.07.1993) /Internetis/ 57 13. Homoseksuaalsus - Juhend õpetajatele ja noortenõustajatele. Koostanud Kotter, L.; Raudsepp, A. [WWW] http://www.parnu.ee/raulpage/koolitus/homoseksuaalsus.html (2.10.2007) /Internetis/ 14
HU (heat-unstable nucleoid protein) on eukarüootsete histoonide prokarüootne homoloog, mis on koos Fis valguga üks põhilisi nukleoidi komponente. Eksponentsiaalselt kasvavates rakkudes on 30000 55000 HU molekuli raku kohta ning sel juhul peaks teoreetiliselt olema DNA-ga seondunud üks HU dimeer iga 300 400 bp tagant. Statsionaarses faasis langeb HU hulk raku kohta 1/3-le eksponentsiaalses faasis mõõdetust. IciA (inhibitor of chromosome initiation A) seondub spetsiifiliselt 3-le 13 nt pikkusele kordusjärjestusele DNA replikatsiooni alguspunkti oriC piirkonnas ning inhibeerib DNA replikatsiooni initsiatsiooni, blokeerides DnaA poolt vahendatud DNA ahelate lahtisulamise oriC regioonis. Eksponentsiaalselt kasvavates rakkudes on 400 IcaA dimeeri ja statsionaarses faasis on IcaA hulk langenud 250 dimeerile. IHF (integration host factor) seondub DNA-ga spetsiifiliselt heterodimeerina. Eksponentsiaalselt
Meat from Duroc postmortem. Raw meat (longissimus lumbo- pigs had high concentrations of 20:5n-3 and rum) from nn pigs had lower visual color 22:6n-3. intensity and homogeneity scores than meat Genetic markers for tenderness have been from NN and Nn pigs. Meat from nn pigs was identified for Duroc-Landrace pigs (Rohrer et less tender than that from NN pigs; the Nn al. 2006). Chromosome 2 region 60–66 cM pigs were intermediate. appears to be associated with all measures of Meat from pigs (Swedish Hampshire x pork tenderness and the region on chromo- Finnish Landrace) that are homozygous some 17 (32–39 cM) was associated with and heterozygous for the rendement napole measures of intramuscular fat and loineye (RN-; acid meat) allele has been shown to be area. juicier than that from noncarriers
It all (seemingly) started in 1559. Realdo Colombo of the University of Padua in Italy announced the discovery of the clitoris and planted his ag: "Since no one has discerned these projections and their workings, if it is permissible to give names to things discovered by me, it should be called the love or sweetness of Venus." Gabriele Falloppio, Realdo's successor and later of Fallopian tube fame, refuted his claim, as did Italians, Danes, and every Y chromosome in between. Hippocrates actually had Realdo beat by more than 1,300 years, but the clitoris seems to periodically go into hiding, often for decades at a time. Is it real? Is it an illusion? Is it alive? Is it dead? No one knew until it made a sudden reappearance, like Osama bin Laden on CNN. It's not hard to understand why men pretend it doesn't exist. If it doesn't exist, or if it's unpredictable, men can write it o as a female problem. If it's purely a female problem, men