Bioinformaatika ülesanded Järjestuste võrdlemine, otsingud andmebaasidest (BLAST, FASTA, SW). 1. BLAST programmide kasutamine tundmatu valgujärjestuse identifitseerimiseks või sarnaste valgujärjestuste leidmiseks (http://www.ncbi.nlm.nih.gov/BLAST/). Programmide kasutamisel tutvuda tutorialite ja juhenditega!!! (http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/information3.html). a. Otsida sarnaseid järjestusi antud valgujärjestusele. Valida sobiv programm vastavalt NCBI juhendile valgujärjestuse võrdlemiseks valgujärjestuste seast. Valida otsimiseks Refseq andmebaas, sooritada otsing, tulemuste formaat 500 joondamise jaoks.
April brings the primrose sweet, Scatters daisies at our feet. May brings flocks of pretty lambs, Sporting round their fleecy dams. June brings tulips, lilies, rose, Fills the children's hands with posies. Hot July brings thundershowers, Apricots, and gillyflowers. August brings the sheaves of corn; Then the harvest home is borne. Warm September brings the fruit; Sportsmen then begin to shoot. Brown October brings the pheasant, Then to gather nuts is pleasant. Dull November brings the blast-- Hark! the leaves are whirling fast. Cold December brings the sleet, Blazing fire, and Christmas treat. The Alphabet Song ABCDE Stand up and look at me! FGHIJ I play football every day! KLMNO I like cake, oh, oh, oh! PQRST Hey people. Listen to me UVWXYZ The alphabet is in my head!
· 2 other ships sunk · 3 cruisers damaged · 3 destroyers damaged · 3 other ships damaged · 188 aircrafts destroyed · 159 aircrafts damaged · 2,335 killed · 1,143 wounded Aftermath · Total destruction of Hiroshima · 70 000 killed instantly · Another 70 000 dead by the end of 1945 Little Boy The codename for the atomic bomb · Weight - 4,400 kg · Length - 3.0 m · Diameter - 71 cm · Blast yield - 15 kilotons Interesting facts · The Flame of Peace in Hiroshima · Tsutomu Yamaguchi · The closest known survivor · Kyoto was spared because the american Secretary of War had spent his honeymoon there Hiroshima today Radiation free Modern city with skyscrapers The A-Bomb Dome References https://en.wikipedia.org/wiki/Little_Boy http://www.telegraph.co
Cooling: 60,000 tons of cooling capacity Antenna: 360 feet high Capacity: 50,000 Employees Satellite Photo - Lower Manhattan WTC Manhattan Prior to Attack WTC Looking Up AA Flight 11 Boston to LAX Hit the North Tower at 8:45 AM United Flight 175 Boston to LAX Hit the South Tower at 9:03 AM Flight Paths of Attack UAL Flight 175 Hitting South Tower AA Flight 11 Hit the North Tower Satellite Photo of NY & NJ Smoke from Burning Towers South Tower Blast Both Towers - Burning From Brooklyn Bridge From Empire State Building South Tower Collapsing Falling Bodies Lone Man - Fleeing Avalanche Car on its End WTC Bldg # 7 Skyline Before & After Attack God Bless America I am certain that, however great the hardships and the trials which loom ahead, our AMERICA will endure and the cause of human freedom will triumph...
märts 1978 Hüüdnimi: Monkeyboy Hobby: lumelaud Lemmik filmid: 1. Drunken Master 2, Black Mask, Man On the Moon Mask: Suht meenutab gaasimaski #1 Nimi: Joey Jordison Bändis: Trummid Sündinud: 26. aprill 1975 Hüüdnimi: Superball Hobby: põhiliselt muusika 24/7, video mängud, magamine ja sex Mask: Jaapani "kabuki" mask, värvitud musta ja punasega "tumedama" väljanägemiseks. Muud bändid: Mängib bändis "Murderdolls" kitarri Vanad bändid: Avanga, MOdifidious, The Rejects, Anal Blast, Body Pit, The Pale Ones #2 Nimi: Paul Grey Bändis: Bassist Sündinud: 08. aprill 1972 Hüüdnimi: Balls Mask: Lateks põrssa näo mask Vanad bändid: VeXX, Inveigh Catharsis, Body Pit, Anal Blast #3 Nimi: Chris Fehn Bändis: Percussionist Sündinud: 24. veebruar 1972 Mask: Kannab Pinokkio tüüpi maski, mille nina on umbes 7-8 inchi pikk Vanad bändid: Varem mängis bändis SHED #4 Nimi: James Root Bändis: Kitarr Sündinud: 02. oktoober 1971 Hüüdnimi: The Peach
TAKE FOR = consider, view Don't take him for an idiot... he's actually quite smart. TAKE IN = A. learn B. deceive C. make smaller D. watch A. Many students have difficulties taking in all these phrasal verbs. B. She was taken in by the smooth talking salesman. C. The tailor took in my jacket after I lost weight. D. Let's take in a movie sometime. TAKE OFF = A. launch plane or rocket B. remove C. leave work for some time D. leave A. The rocket took off with a loud blast and cloud of smoke. D. We took off after the last bell rang. TAKE ON = accept responsibilities She has taken on more than she can handle I'm afraid. TAKE OVER = take control of Mike took over the family business when his father retired. TAKE OUT = A. date, court B. kill C. remove A. I am taking Jill out to a movie tonight. B. The mob ordered a hit on three fingers Tony. They are going to take him out. TAKE TO = A. like B. adjust naturally A
histiotsüüt Elastsed kiud (makrofaag) rasvarakk kapillaar peritsüüt neutrofiil plasmarakk fibro- blast Kolla- geensed kiud lümfotsüüt nuumrakk Makrofaagid (histiotsüüt) · Histiotsüüdid on suhteliselt suured (10-20 µm) ebakorrapärase kontuurjoonega rakud · Tuum on ümar või ellipsoidne; tsütoplasma koosneb hästi arenenud Golgi kompleksist ja
· Kõhrkude kasvab interstitsiaalse ja apositsioonilise kasvu teel · Interstitsiaalne kasv - rakkude jagunemise kõhrkoe sees · Apositsiooniline kasv - perikondri sisemise kihi (kondrogeenne kiht) rakkude diferentseerumine kondroblastideks · Nimetatud kahel viisil toimub uue kõhre moodustumine kõhresiseselt (interstitsiaalne kasv) ja kõhre välispinnal (apositsionaalne kasv) Kõhrkoe kaks kasvuviisi Peri- konder Kondro- 1 blast Kondro- tsüüt 2 Maatriks 1 = apositsionaalse kasvu vöönd 2 = interstitsiaalse kasvu vöönd Kõhrkoe regeneratsioon · Perikondri kondrogeenne aktiivsus piirdub organismi kasvuperioodiga enne täiskasvanuiga · Täiskasvanul toimub regeneratsioon perikondri ja ümbritseva sidekoe arvel, millest vohanud noor sidekude (granulatsioonkude) täidab kõhre defekti · Noore sidekoe rakud võivad muutuda kõhre
I get happy for even the slightest bit of things such as getting a good grade or having a nice evening with my friends and just when I see someone else happy and smiling makes me smile too. I am a total opposite to those who stress about nothing. That is why usually I am the one who talks pointless jokes and stories and just does crazy things to entertain others. I just do not care what random people think of me as long as me and my friends are having a blast. Honestly, I think that it depends on one's mind, if you really want then happiness will fall in place.
Isiklik arvamus Teoorias ei võiks sellist teemat isegi mitte eksisteerida, kuna arvan, et sõda üleüldiselt ei ole optimaalne viis lahendamaks lahkhelisid osapoolte vahel. Siiski on pildid küllaltki huvitavad, ning kindlasti väärtustan fotograafide vaeva, kes seavad enda elu ohtu selliste fotode jäädvustamiseks. Kasutatud kirjandus 1. https://en.wikipedia.org/wiki/War_photography 2. https://iht-retrospective.blogs.nytimes.com/2015/03/02/1965-jets-blast-north- vietnam/ 3. https://www.aljazeera.com/indepth/features/2017/05/evolution-war-photography- 170525114200990.html
Overall, they are enjoying themselves, but with what price? I have experienced that on myself. On a summer few years ago I almost didn't leave my home for the whole summer at all. By home I mean my village and the only exception was that I had a disease for a few weeks and I had to go to the doctor's in Tartu. As you can assume, I live at countryside, so I mostly socialized with my family, neighbours and of course, online. When I finally went back to the civilized world I had a blast. I was afraid, cautious and most of all retarded at communicating. I have experienced what too much virtual communication can do to us and believe me you don't want to try it. While having some negative sides, virtual communication is generally still a very good thing because thanks to this advanced technology people from countries around the globe can communicate quickly and easily every day. And not only ordinary people use it; virtual
vähkkasvajad. Ka nende lapsed ja lapselapsed pole ohu eest kaitstud, sest radioaktiivkiirgus kahjustab sugurakka ja kutsub järeltulijatel esile väärarenguid. Radioaktiivset kiirgust pole võimalik näha, kuulda, tunda, maitsta ega tunda selle lõhna. Piir,kust alates radioaktiivne kiirgus pidavat ohtlik olema, on ainuüksi hinnanguline. Tuumaplahvatuse efektid Tuumapommiplahvatuses tekkinud energia jaotub järgmiselt: Lööklaine (Blast)--40-60% energiast Termiline radiatsioon (Thermal radiation)--30-50% energiast Ioniseeriv radiatsioon (Ionizing radiation)--5% energiast Jääk (Residual radiation)--5-10% kogu energiast Tuumapommide testimine Tuumapommide testimine annab informatsiooni: kuidas relvad töötavad, kuidas käituvad erinevates olukordades ja millist mõju ümbritsevale osutavad. Esimese aatompommi Trinity testimine oli USA-s 16. juunil 1945 (võimsus umb. 20 kt).
· Mesenhüüm tiheneb tulevaste luude formeerumise kohal · Väikesed käävjad rakud hakkavad tootma kollageenseid kiude ning kogu piirkond meenutab kiulist membraani · Osteoblastid jätkavad kollageensete kiudude ja põhiaine (osteoidi) moodustamist · Osteoid muutub luumaatriksiks kaltsiumi soolade ladestumisel. Tootes luusubstantsi jäävad osteoblastid selle sisse ja muutuvad osteotsüütideks Osteo- Osteo- Mesen- Luu Osteo- klast tsüüt hüüm maatriks Osteoid blast Kondraalne ossifikatsioon 1 · Asendusluud tekivad hüaliinsest kõhrkoest primordiaalse skeleti asendumisel luukoega · Kõhre asendumine luukoega toimub kahel viisil: kõhre pinnal e. perikondraalselt ja kõhre sees e. en(do)kondraalselt Kondraalne ossifikatsioon 2 · Diafüüsi ümber tekib perikondraalne luumansett · Kõhre toitumine häirub, põhiaine kaltsifitseerub - luustumistuum e. ossifikatsioonitsenter · Mesenhümaalne kude tungib periostaalpungana läbi
-glükosidaas (eskuliin) ja -galaktosidaas andsid positiivse tulemuse. Arginiini dihüdrolaas, ureaas ja DNaasi testid olid negatiivsed. 5. kasv temperatuuril, NaCl kontsentratsioonidel ja pH-l 37 °C juures kasv puudus täielikult, kuid 42 °C juures esines. Maksimaalne soolataluvus oli 7% juures, kuid eelistas (kõige tugevam kasv) 0% juures kasvada. Kõige nõrgem kasv oli pH 3 juures ja tugevaim alates pH 9-st kuni 11-ni. 6. 16S rRNA geeni järjestus Kasutades BLAST andmebaasi ja tundmatu tüve 16S rRNA järjestust, sain lõpuks tulemuseks Enterobacter aerogenes'i. Tüve 33 ja E. aerogenes'i 16S rRNA järjestuste samasus on 99%. 7. Antibiootikumide efektiivsuse testimine Kasutades Kirby-Baueri meetodit, sain tulemuseks: Resistentne Keskmine Tundlik Tetratsükliin Streptomütsiin Amoksitsilliin+klavulaanhap
projektidega ja lihtsalt puhkasid. 2003 Aasta jooksul viibiti peamiselt tuuridega välismaal. Oktoobris ilmus ka nende DVD "End Of Innocence". 2004 Alustati uue albumi lindistamist, mis seekord valmis koostöös Londoni sümfooniaorkestriga Pip William'si juhendamisel. Esimeseks singliks oli "Nemo" ja sellele valmis ka video, mille rezissööriks tuntud soomlane Antti Jokinen. Muudeti ka plaadifirmat - senise Spinefarmi asemel hakkas plaate välismaal välja andma Nuclear Blast. Uus album "Once" kuulutati kuldplaadiks selle väljaandmise päeval. Sellele järgnes ulatuslik tuur mööda Euroopat, Lõuna-Ameerikat, Kanadat, Jaapanit ja Austraaliat. Teine singel "Wish I Had An Angel" ilmus sügisel. Filmiti ka video, mille rezissööriks oli Uwe Boll ja see sisaldas katkeid tema filmist "Alone In The Dark". 2005 Juulis avaldati uusversioon singlist "Sleeping Sun", millele tehti ka uus video. Singel avaldati ka uue kogumike peal "Highest Hopes"
kõik anti ainult hetkeks, ei õnnel ega valul püsi pikk, me tänapäev on kohe valmis retkeks ning ainus, mis ei kao, on kaduvik. MUTABILITY We are as clouds that veil the midnight moon; How restlessly they speed, and gleam, and quiver, Streaking the darkness radiantly! yet soon Night closes round, and they are lost for ever: Or like forgotten lyres, whose dissonant strings Give various response to each varying blast, To whose frail frame no second motion brings One mood or modulation like the last. We rest. A dream has power to poison sleep; We rise. One wandering though pollutes the day; We feel, conceive or reason, laugh or weep; Embrace fond woe, or cast our cares away: It is the same! for, be it joy or sorrow, The path of its departure still is free: Man's yesterday may ne'er be like his tomorrow; Nought may endure but Mutability.
2. TSEMENT “Portland cement is the basic ingredient of concrete. Concrete is formed when portland cement creates a paste with water that binds with sand and rock to harden. Cement is manufactured through a closely controlled chemical combination of calcium, silicon, aluminum, iron and other ingredients. Common materials used to manufacture cement include limestone, shells, and chalk or marl combined with shale, clay, slate, blast furnace slag, silica sand, and iron ore. These ingredients, when heated at high temperatures form a rock-like substance that is ground into the fine powder that we commonly think of as cement”. [1] “Tsement on hüdrauliliste sideainete hulka kuuluv laialt kasutatav ehitusmaterjal. Seda kasutatakse suure tugevuse ja kõvaduse saavutamiseks, eriti betooni tootmisel. Tsementi kasutatakse maa- või
its helium and shrivels. It turns into a white dwarf about the size of Earth, aging and cooling indefinitely--unless it lies close enough to another star to steal its neighbor's outer layers of hydrogen. If enough material falls onto the white dwarf, the siphoned fuel ignites a thermonuclear explosion. As the detonation spreads, the entire star blows up in what is known as a type 1a supernova--a giant nuclear bomb. The supernova blossoming over Palomar was a different kind: not a thermonuclear blast but a star's catastrophic collapse. This is the only kind of supernova that can unleash a gamma-ray burst, and it is the inevitable fate of a star more than eight times as massive as the sun. Such heavyweight stars always lose their battle with gravity. With the crushing weight of the star's outer layers bearing down on its core, the fusion reactions don't stop at carbon. The star continues to cook lighter nuclei into progressively heavier elements, but each nuclear reaction
Ka nende lapsed ja lapselapsed pole ohu eest kaitstud, sest radioaktiivkiirgus kahjustab sugurakka ja kutsub järeltulijatel esile väärarenguid. · Radioaktiivset kiirgust pole võimalik näha, kuulda, tunda, maitsta ega tunda selle lõhna. Piir,kust alates radioaktiivne kiirgus pidavat ohtlik olema, on ainuüksi hinnanguline. Tuumaplahvatuse efektid Tuumapommiplahvatuses tekkinud energia jaotub järgmiselt: · Lööklaine (Blast)--40-60% energiast · Termiline radiatsioon (Thermal radiation)--30-50% energiast · Ioniseeriv radiatsioon (Ionizing radiation)--5% energiast · Jääk (Residual radiation)--5-10% kogu energiast Tuumapommide testimine · Tuumapommide testimine annab informatsiooni: kuidas relvad töötavad, kuidas käituvad erinevates olukordades ja millist mõju ümbritsevale osutavad.
restriktaas ei ole kuskilt mujalt lõiganud. Praktiline töö nr.9: Bioinformaatiline sekveneerimise tulemuste analüüs Eesmärk: Kloneeritud plasmiidi sekventsi analüüs ja ümberkloneerimise plaani koostamine Töö käik ja analüüs: 14 Mina valisin DST_T7_E10.ab1 failist sekventsi Sekventsi kvaliteedi hinnang: Väga hea kvaliteet, usaldusväärsuse vahemik on suur ja tausmüra on väga vähe. Usaldusväärsuse vahemik : 23-820 Blast ja selle tulemused: 1. Identities 632/632 ehk kõik nukleotiidid klapivad ja ei ole toimunud mutatsioone. 2. Gaps 0/632 ehk ei ole eemaldatud või juurde lisatud kuskile nukleotiide. 3. Strand Plus/Miinus ehk sisestatud insert on sisenenud vektorisse tagurpidi ja transkripstsiooni suund on vastupäeva. Tegemist on tõepoolest DST geeniga, mis me sisestasime. Kontrollisin ka vektori järjestust ja see klapib 100% pSTBlue-1 kloneerimisvektori järjestusega.
in 1979, collected only about 100 cosmic rays between element 75 and element 87 (the group of elements that includes platinum, mercury, and lead), in almost a year and a half of flight, and it was much bigger than most scientific instruments flown by NASA today. To make better measurements requires an even larger instrument, and the bigger the instrument, the greater the cost. Where do they come from? Most galactic cosmic rays are probably accelerated in the blast waves ofsupernova remnants. This doesn't mean that the supernova explosion itself gets the particles up to these speeds. The remnants of the explosions, expanding clouds of gas and magnetic field, can last for thousands of years, and this is where cosmic rays are accelerated. Bouncing back and forth in the magnetic field of the remnant randomly lets some of the particles gain energy, and become cosmic rays. Eventually they
lahust? On vaja pipeteerida 8µl 0,5M EDTA lahust. 13 Töö nr 6: Rekombinantse DNA järestuse bioinformaatiline analüüs (teostatakse auditooriumis/arvutiruumis või iseseisvalt) (1) Saadud DNA järjestuse editeerimine, vastavalt saadud elektroforegrammile, kasutades programme MS Word, DNAMAN, Chromas, jt. plasmiidii osa lahutamine. (2) DNA järjestuse võrdlemine andmepankades olevate tuntud järjestustega kasutades BLASTN, MEGABLAST, BLAST 2 sequences jt programme (http://www.ncbi.nlm.nih.gov/) (3) "CpG island"i identifitseerimine inimese kromosoomis (BLAT programm, http://genome.ucsc.edu/cgi-bin/hgBlat) Proov nr.8. CTGAATGGGGGCCCCCCCCCTCAGGGTCGACGGTATCGATAAGCTTGGATATCGAATTCC TGCAGCCCGGGGGATCCACTAGATTTAGAGCGGCCGCCACCGCGGCAGGCCGACGGCCCC ACGGAGGGACATTGAAGGGGAAGTGGAGGAGAAGAGCAGGGGCGACCCGGAGGGGTGGC TGGGCCGGGGCGGGCAAGACAGTCTCAGGGCCCGGCAGCCGCCCGGGGTTGGCTAATTTCT
toorikusse suletud kontuuri mööda, kusjuures eraldatud osa on jäätmeks. Sälkamisel (e) eraldatakse materjali tooriku servast. Sisselõikamine (f) toimub mööda avatud kontuuri, ilma materjali eraldamiseta. Sisselõikamist tehakse tavaliselt Kõrgahju tooriku mingi osa painutamiseks tasapinnast välja. Äralõikamine (g) on viimistlev operatsioon näiteks Kõrgahjuprotsess: Kõrgahi (blast viimistlevaks töötlemiseks jäetud varu või kraadi eemaldamiseks stantsitud tootelt. Puhastamine (h) furnace) kujutab endast on viimistlusoperatsioon stantsise servadepinnakvaliteedi vastuvoolu põhimõttel pideva parandamiseks ning täpsuse reziimiga töötavat sahtahju, suurendamiseks.
düüsiventiil nozzle-control valve ekraanküttepind water screen gaasikäik gas flue, gas passage gaasisiiber flap, flapper valve horisontaalne leektorukatel horizontal fire-tube boiler kahekontuuriline katel double-evaporation boiler kaitseklapp safety valve katla tõmme boiler air draft katlakivi scale katlaventilaator blast fan, forced draft fan kaudse toimega kaitseklapp, impulse safety valve impulsskaitseklapp keemistemperatuuur boiling temperature keevitatud ketasrootor welde disc rotor ketasrootor discrotor soojuskiirgus heat radiation kiirusastmega aktiivturbiin Curtis turbine kolbaurumasin steam engine kolde läbipuhumine purge koldemüüritis fire-brick lining kolle furnace
backlash (n) baggage (n unc) bait (n) 2 baked (adj) ballerina (n) bank (n) bank balance (n) barbecued (adj) bare (adj) barely (adv) barge (n) barrier (n) based (on) (adj) bat (n) battery (n) battle it out (phr) battlefield (n) be at a loose end (idm) be better off (idm) be dying to (idm) be set to (v) beak (n) beg (v) behave (v) bellow (v) benefit (n) bestseller (n) binoculars (n pl) biodiesel (n) bit of a handful (phr) bitter (adj) blade (n) blame (v) blast off (phr v) blind (adj) blink (v) blister (n) block (v) board (v) boarding pass (n) boast (v) boo (v) boost (v) boot (n) bossy (adj) brain scan (n) break a record (phr) break out (phr v) breakdown (n) breakthrough (n) breathtaking (adj) 3 breezy (adj) brief (adj) broken-down (adj) brontosaurus (n) bronze (adj) bruise (n) buggy (n) burglar (n) burn an album (phr) burst of laughter (n) bushy (adj) by consequence (adv) C cabin (n) cabinet (n) cadet (n) calculator (n)
39. Academic Press, New York. Kamaletdinowa, F.I. & Vassilyev, A.E. 1982. Cytology of Discomycetes. Alma-Ata, 176 pp. Kempken, F. 1995. Horizontal transfer of a mitochondrial plasmid. Molecular & General Genetics 248: 89-94. Kempken, F. & Kuck, U. 1998. Transposons in filamentous fungi--facts and perspectives. Bioessays 20: 652-659. Kim, N.S., Park, N.I., Kim, S.H., Kim, S.T., Han, S.S. & Kang, K.Y. 2000. Isolation of TC/AG repeat microsatellite sequences for fingerprinting rice blast fungus and their possible horizontal transfer to plant species. Molecules and Cells 10: 127-134. Kivisild, T. & Villems, R. 2000. Questioning evidence for recombination in human mitochondrial DNA. Science 288:1931. Kohli, Y. & Kohn, L.M. 1998. Detection of random association among loci in clonal populations of Sclerotinia sclerotiorum. Fungal Genetics and Biology 23: 139-149. Kullman, B. 2000. Application of flow cytometry for measurement of nuclear DNA content in fungi
Töö nr 6: Rekombinantse DNA järestuse bioinformaatiline analüüs (teostatakse auditooriumis/arvutiruumis või iseseisvalt) (1) Saadud DNA järjestuse editeerimine, vastavalt saadud elektroforegrammile, kasutades programme MS Word, DNAMAN, Chromas, jt. plasmiidii osa lahutamine. (2) DNA järjestuse võrdlemine andmepankades olevate tuntud järjestustega kasutades BLASTN, MEGABLAST, BLAST 2 sequences jt programme (http://www.ncbi.nlm.nih.gov/) (3) "CpG island"i identifitseerimine inimese kromosoomis (BLAT programm, http://genome.ucsc.edu/cgi-bin/hgBlat) 109 nukleotiidi CCGCGGGTCGGCGGGGAGGTTGGGCCCAGGGATAAAAGAACTGGGGCTGGTGGGGGGGA GGGGTTCCCGGCCTAGGGGAAGGGCTATGACAATGGAATGACAACCGCGG Homo sapiens chromosome 15 genomic scaffold, alternate assembly CHM1_1.0 Sequence ID: ref|NW_004078084
Tool storage capacity 24 Max. tool diameter (without adjacent tools) 80 mm Max. tool length 300 mm Max. tool mass 7 kg Tool change time (chip-to-chip) 4 secs Coolant Through spindle coolant 20 bar Swarf Removal Chip Auger Cutter air blast Standard Accuracy ISO 230-2 Positioning Ap 0.010 mm Repeatability Ru 0.004 mm Machine size Machine height 2940 mm Floor space 2510 x 2665 mm Mass of machine 5830 kg
spetsiaalne keel CL DATA (Inglise: Cutter Location Data). 54. Lause otspinna töötlemiseks 55.Teeriku liikumise trajektoor Lõiketöötluse efektiivsus sõltub esmajoones lõikuri teriku (lõikuri Kõrgahju lõikava osa) materjali ja geomeetria valikust. 56. Elektroerosioontöötlemine Kõrgahjuprotsess: Kõrgahi (blast furnace) kujutab endast Elektroerosioontöötlemine põhineb elektrikontaktikohtade purunemisnähul, mille põhjus on kontaktidevaheline sädelahendus. vastuvoolu põhimõttel pideva Meetod on rakendatav vaid elektrit juhtivate materjalide töötlemisel. režiimiga töötavat šahtahju, Üks elektroodidest on tööriist, teine töödeldav ese.Nende vahel on
we're gonna clock now get money evade bitches evade tricks give players plenty space and basicaly just represent for you baby next time you see your niggas your gonna be on top nigga their gonna be like, 'Goddamn, them niggas came up' that's right baby life goes on.... and we up out this bitch hey Kato, Mental y'all niggas make sure it's popin' when we get up there don't front. Changes Come on come on I see no changes. Wake up in the morning and I ask myself, "Is life worth living? Should I blast myself?" I'm tired of bein' poor and even worse I'm black. My stomach hurts, so I'm lookin' for a purse to snatch. Cops give a damn about a negro? Pull the trigger, kill a nigga, he's a hero. Give the crack to the kids who the hell cares? One less hungry mouth on the welfare. First ship 'em dope & let 'em deal the brothers. Give 'em guns, step back, and watch 'em kill each other. "It's time to fight back", that's what Huey said. 2 shots in the dark now Huey's dead.
10 Disasters in the sun; and the moist star Upon whose influence Neptune's empire stands Was sick almost to doomsday with eclipse: And even the like precurse of fierce events, As harbingers preceding still the fates And prologue to the omen coming on, Have heaven and earth together demonstrated Unto our climatures and countrymen.— But soft, behold! lo, where it comes again! Re-enter Ghost I'll cross it, though it blast me. Stay, illusion! If thou hast any sound, or use of voice, Speak to me: If there be any good thing to be done, That may to thee do ease and grace to me, Speak to me: Cock crows If thou art privy to thy country's fate, Which, happily, foreknowing may avoid, O, speak! Or if thou hast uphoarded in thy life Extorted treasure in the womb of earth, For which, they say, you spirits oft walk in death, Speak of it: stay, and speak! Stop it, Marcellus. MARCELLUS Shall I strike at it with my partisan
BIST Built-In Self-Test BiSYNC (See BSYNC) BIT Binary Digit BITNET Because It's Time Network BITNIC Bitnet Network Information Center BIU Bus Interface Unit BIW Business Intelligence Warehouse [SAP] BIX Byte Information Exchange (BBS) .BIZ Businesses (Domain Name) [Internet] .BK! Backup (file name extension) [WordPerfect] .B~K Backup (file name extension) BKSP Backspace BL Backlit + Bit Line BLAS Basic Linear Algebra Subroutines BLAST Bell Labs Layered Space Time + Blocked Asynchronous Transmission (protocol) [Communications Research Group] .BLD BASIC Bload Graphics (file name extension) BLE Branch if Less or Equal BLER Block Error BLI Business Logic Integration [Microsoft] BLK Block BLMC Buried Logic Macrocell BLOB Binary Large Object BLOG Web Log BLOS Branch if Lower Or Same BMI Branch if Minus BMIC BusMaster Interface Controller [Intel]
redness after thawing. In contrast, meat retail-sized portions are first packed in film frozen in liquid nitrogen and then defrosted to exclude air between the meat surface and was a light bright red. Little difference was the film and then rapidly frozen. With this also found between thawed beefsteaks that product, however, the price differential were frozen at 15 cm h−1 in liquid nitrogen between fresh and frozen would necessarily spray and those that were blast frozen at be small, and the consumer would have to be 4 cm h−1 (Pap 1972). In thawed meat, the rate persuaded by the trade that such frozen meat of pigment oxidation is increased (Cutting was in no way inferior to fresh. 1970), and therefore, the color will be less stable than in fresh. On prolonged frozen Freezing Systems for Meat storage, a dark brown layer of metmyoglobin
Once again the story seems stuck, a n d A t h e n a unsticks it by taking the form of Telemachus' teacher Mentor. In this disguise she drums some courage into him and helps him assemble a ship and crew. Therefore, even though Mentor is the name we give to wise counselors and guides, it is really the goddess Athena who acts here. Athena is the full, undiluted energy of the archetype. If she appeared in her true form, it would probably blast the skin off the bones of the strongest hero. T h e gods usually speak to us through the filter of other people who are temporarily filled with a godlike spirit. A good teacher or Mentor is enthused about learning. T h e won derful thing is that this feeling can be communicated to students or to an audience. T h e names M e n t e s and Mentor, along with our word "mental," stem from the Greek word for mind, tnenos, a marvelously flexible word that can mean intention,
"Is this so awful for you?" I asked, rocking my hips. "Are you lying there thinking you're not giving me what I want because I'm in charge?" Gideon set his hands on my thighs. Even that innocuous touch seemed dominating. The edginess and sharpened focus I'd detected not long ago abruptly made sense to me-he wasn't restraining his force of will anymore. The tremendous power coiled inside him was now directed at me like a blast of heat. "I've told you before," he said huskily. "I'll take you however I can get you." "Whatever. Don't think I don't know you're topping from the bottom." His mouth curved with unapologetic amusement. Sliding down, I teased the flat disk of his nipple with the tip of my tongue. I blanketed him as he'd done to me in the past, stretching my body over his hips and legs, my hands shoving beneath his gorgeous ass to squeeze the firm flesh and hold him tight against me
precisely synchronized with that of the scrambler, subtracts the phonograph signal out, leaving the voice. These systems resemble null ciphers, which interlard the true message within a welter of spurious symbols. Another system is wave-form modification. A fluctuating electrical current operates upon the voice current to produce rapid and extreme variations in the amplitude of the transmitted speech. This sounds rather like a radio whose volume control is being turned up to full blast one instant and then down to a whisper the next. In the descrambler, an identical synchronized current reverses these effects. All these encipherments transform the speech only in the frequency dimension, along the vertical axis, as it were. None extends horizontally along the time axis. Systems that encipher by changing the temporal relationships of speech's continuous flow must preserve it momentarily to permit the transposition. Usually they have used magnetic tape.
annaabi.ee 
