SÕNAD! täiteaine-aggregate Sideaine-binder Toornafta-crude oil Bituumen(põhja-A)- Bituumen mujal maailmas-bitumen Pressitud killustikkate-macadam Osake-particle Maardla-mineral deposit Puhastatud, rafineeritud jääk- a Regined residue Defineeri sõnad? Asphalt-“Asphalt” is a dark brown to black, highly viscous, hydrocarbon produced from petroleum distillation residue. This distillation can occur naturally, resulting in asphalt lakes, or occur in a petroleum refinery using crude oil. Slurry-Slurry seal involves a creation of mixture of asphalt emulsioon and fine crushed aggregate that is Spread on the surface of a road chip seal-Chip seal involves spraying the road surface with asphal emulsions followed by crushed rocks or gravel Heat island-The term "heat island" describes built up areas that are hotter than nearby rural areas.
radiation pledge promise officially address the problem deal with the issue desalination removing the salt from the seawater to produce drinking water logistics organization of complex activity naught British variant of zero irreversible unstoppable sediment residue, metter that settles to the vottom of the liquid
Mulch benefit · Extended the seeding season · It keeps the seed bed loose · Shades the seedlings · Keeping the vegetables clean and dry Mulching time · Winter mulch after the first hard frost · Summer mulch as soon as plants are established Pilt1 Mulch materials · Leaves · Manure · Hay · Sawdust · Seaweed · Straw · Grass clippings · Paper · Clover · Crop residue Pilt2 Pilt3 Stone mulching · Suitable for any vegetation · Particularly well for trees, flowers and other decorative vegetation. · Ideal for bacteria, earthworms and other burrowing insects. · Adds minerals to the soil · Adding a bit of glamour to plants Pilt4 Stone mulching bad things · Weeds grow between the stone · You can put new layer of stone or picking up weeds Pilt5
03.13 A: Br2-MeOH + 100mg (0,82 mmol) 4-hüdroksübensaldehüüdi, sulgeda kolb ning loksutada jäävannis 30 sekundit. Võtta mõlemal kolvil korgid pealt ning valada A sisu kolbi B, mille sisu on juba kuum. Replace the cap with the stringe barrel on vial B and heat this mixture in the 130 oC silicon oil bath in a fume hood for one hour. By the end of the hour, most of the solvent that was in vial B will have collected in the syringe barrel and a dark brown residue will remain in vial B. Eemaldada kolb B kuumast ning lasta korralikult maha jahtuda. Eemaldada seejärel kork. Kasutades maksimaalselt 6 ml 3M soolhappe lahust ning kraapides lahti tahke aine, viia B kolvi sisu jaotuslehtrisse. Ekstraheerida 3 x 5 ml etüülatsetaadiga, valada ekstraktid kokku ning kuivatada naatriumsulfaadiga. Transfer the supernatant to a round-bottom flask, add 0.5 g silica gel and place the flask on a rotary
The old regime breaks down. New democratic structures are built. Initial fragility These new structures become embedded; their removal is unthinkable: `consolidation'. Structural factors : Factors that are `unchangeable' or change slowly; `preconditions' · Historical · Economic · Political W. Germany 1950s: educated, literate population, but residue of authoritarian attitudes, poor experience of Weimar democracy? E. Germany 1990s: educated, literate, good knowledge of West German system (relatively) easy adaptation once East German state collapsed Mexico: as economy developed did potential for democratic structures increase? South Africa: little apparent scope for change? Transitions theory 1. liberalization of authoritarian rule 2. civil society pushes the boundaries of change faster and farther 3
Place the beaker under the funnel so that the longer edge of the stem is placed against the wall of the beaker. This ensures the constant flow of the filtrate along the wall of the beaker so there is no chance of drops escaping from the beaker. Figure 1.2 Fill the filter to 3/4 and immediately place the glass rod back into the conical flask. 2) For washing the NaCl out of the sand, add another 50 cm 3 of distilled water to the residue in the conical flask and filter it again into the beaker through the same filter paper. Repeat this once more. In the end wash the filter to carry all of the dissolved salt into the solution. To do that, fill the filter with distilled water and let it drain until the end. Rinse the sand into the sand collector with tap water. 3) Pour the clear filtrate from the funnel into a measuring cylinder and then fill it to 250 cm 3 with distilled water
This is known as the espresso process and is generally suited to preparing individual cups of beverage rather than a jug or container. * Hygiene: All parts of coffee brewing equipment should be regularly cleaned and sanitised and areas that come into contact with the beverage kept clean.In addition the coffee beans or ground coffee should be kept fresh in air tight containers away from damp areas and out of direct sunlight.Coffee beans contain a high percentage of oils and the residue on un-cleaned equipment can quickly form black sticky tars which can easily contaminate the next brew. All coffee brewing equipment and surrounding areas should be washed down with hot water containing a mild detergent and thoroughly rinsed.To produce great tasting coffee is is crucial to have clean brewing equipment.
from which it is derived. Humiinhape Keemiline valem Humiinhape Humic acid has the average chemical formula C187H186O89N9S1 and is insoluble in strong acid (pH = 1). One of two classes of natural acidic organic polymer that can be extracted from humus found in soil, sediment, or aquatic environments. The process by which humic acid forms in humus is not well understood, but the consensus is that it accumulates gradually as a residue from the metabolism of microorganisms. Transition and heavy metals--for example, Fe3+ or Pb2+--as well as other compounds having aromatic or hydrophobic (water-insoluble) chemical structures (i.e., organic pesticides or anthropogenic hydrocarbons), react strongly with humic acid. This property makes it an effective agent in sequestering many of the pollutants in terrestrial and aquatic environments. Fulvohape Väiksema molekulmassiga kui humiinhape.
Clinical Biochemistry 38 (2005) 328. 5. Lisamiskatsed. Reaalse prooviga sarnanevat nullmaatriksit rikastatakse analüüdilahusega ning proovi töödeldakse vastavalt ettevalmistuseeskirjadele. Antud juhul hinnatakse prooviettevalmistuse ja analüüsimeetodi summaarset efektiivsust, kus on kokku võetud nii maatriksimõjud kui ka analüüsi saagis. [60]. A. Kruve, A. Künnapas, K. Herodes, I. Leito, Matrix effects in pesticide multi-residue analysis by liquid chromatographymass spectrometry. J. Chrom. A 1187 (2008) 58. Rutiinanalüüsidega tegelevates laborites on otstarbekas kasutada maatriksiefekti olemasolu kindlakstegemiseks lisamiskatseid ning efekti esinemisel analüüsida lahjendatud prooviekstrakti.
environmental changes. Global warming is hypothesised to alter both above- and below ground processes affecting the soil ecosystem (Asher et al. 2012). As an example, Asher et al. (2012) further proved in their research on humus creation that thermal conditions (due to differences in altitude and exposure) and consequently the climate influence soil microflora considerably. Humus being defined as an organic residue in the soil resulting from decomposition of plant and animal residues in soil, or it is the highly complex organic residual matter in soil which is not readily degraded by microorganism (Kausadikari). There are several other variables that impact the soil microflora. For instance, a study by Canbolat et al. (2007) showed that root length, root and shoot weight of plants were decreased by soil compaction, which suggests that microfloral activity in compact soil is lower. Cultural practices
mootorisse, mis töötab täismineraalõli või AD-õliga. NB! Igasugune eri tüüpi õlide omavaheline segamine on äärmiselt kahtlane! Õli vahetusel jälgi kindlasti tootjatehase poolseid ettekirjutisi! Mootori õlide hindamine toimub järgmiste parameetrite abil: a) viskoossus (viscosity), b) viskoossuse indeks (viscosity index), c) voolavus (gravity API), d) värvus (color), e) hangumistemperatuur (pour point), f) leekpunkt (flash point), g) koksiarv (carbon residue rating); h) pindmärgumine (surface wettings), i) värvus. Vähendab hõõrdumist Liikuvate pindade vahelise hõõrdejõu vähendamiseks suunatakse nende vahele õli kile, mis märgab tööpindu ja täidab nendel asetsevaid lohke ning auke. Edasine tööpindade vaheline hõõrdetakistuse suurus sõltub õli viskoossusest ja pindade vahelisest lõtkust. Jahutab tööpindasid Õli on tihedas kokkupuutes liikuvate detailidega ja imeb endasse osa põlemisprotsessis tekkinud soojust
ttaccatgtttccgccgacctgaccggtcaggcaaaccatctggcggcaaccatcggtgc agatatcgtcaaacaaaaaatggcggaaaataacggcggctataaagcaattaattacgg ttacaccgacgatcgtgtttacagcaaattgaccagcgaaaacccgattgatctggtgcg ttatcagttagctaactgctatatgggtcgggctgggttgataaactccggcggtgctgc gggcggtgaaactgacctcagcgatgcagtgcgtactgcggttatcaacaaacgcgcagg cggaatggggctgattcttggacgtaaagcgttcaagaaatcgatggctgacggcgtgaa actgattaacgccgtgcaggacgtttatctcgatagcaaaattactatcgcctga 2) CpG Islands CpG Islands results Results for 1053 residue sequence "eco:b2097 fbaB, dhnA; fructose-bisphosphate aldolase class I [EC:4.1.2.13]; K01623 fructose-bisphosphate aldolase, class I (N)" starting "atgacagata" CpG island detected in region 3 to 202 (Obs/Exp = 1.18 and %GC = 50.50) CpG island detected in region 18 to 217 (Obs/Exp = 1.19 and %GC = 50.50) CpG island detected in region 21 to 220 (Obs/Exp = 1.19 and %GC = 50.50) CpG island detected in region 24 to 223 (Obs/Exp = 1.19 and %GC = 50.50)
The raw score S for an alignment is calculated by summing the scores for each aligned position and the scores for gaps. In this figure, a DNA alignment is shown. In amino acid alignments, the score for an identity or a substitution is given by the specified substitution matrix (e.g. BLOSUM62). BLAST 2.0 and PSI-BLAST use "affine gap costs" which charge the score -a for the existence of a gap, and the score -b for each residue in the gap. A gap of k residues therefore receives a total score of -(a+bk) and a gap of length 1 receives the score -(a+b). Gap creation and extension variables a and b are inherent to the scoring system in use (BLAST 2.0 defaults). Gap: A space introduced into an alignment to compensate for insertions and deletions in one sequence relative to another. To prevent the accumulation of too many gaps in
[2] [edit]5' Processing Main article: 5' cap [edit]Capping Capping of the pre-mRNA involves the addition of 7-methylguanosine (m7G) to the 5' end. To achieve this, the terminal 5' phosphate requires removal, which is done with the aid of aphosphatase enzyme. The enzyme guanosyl transferase then catalyses the reaction, which produces the diphosphate 5' end. The diphosphate 5' prime end then attacks the gamma phosphorus atom of a GTP molecule in order to add the guanine residue in a 5'5' triphosphate link. The enzyme (guanine- N7-)-methyltransferase ("cap MTase") transfers a methyl group from S-adenosyl methionine to the guanine ring.[3] This type of cap, with just the (m7G) in position is called a cap 0 structure. The ribose of the adjacent nucleotidemay also be methylated to give a cap 1. Methylation of nucleotides downstream of the RNA molecule produce cap 2, cap 3 structures and so on. In
[2] [edit]5' Processing Main article: 5' cap [edit]Capping Capping of the pre-mRNA involves the addition of 7-methylguanosine (m7G) to the 5' end. To achieve this, the terminal 5' phosphate requires removal, which is done with the aid of aphosphatase enzyme. The enzyme guanosyl transferase then catalyses the reaction, which produces the diphosphate 5' end. The diphosphate 5' prime end then attacks the gamma phosphorus atom of a GTP molecule in order to add the guanine residue in a 5'5' triphosphate link. The enzyme (guanine- N7-)-methyltransferase ("cap MTase") transfers a methyl group from S-adenosyl methionine to the guanine ring.[3] This type of cap, with just the (m7G) in position is called a cap 0 structure. The ribose of the adjacent nucleotidemay also be methylated to give a cap 1. Methylation of nucleotides downstream of the RNA molecule produce cap 2, cap 3 structures and so on. In
respect. Corn, wheat, rye and sorghum are rated medium, and sugarbeet and barley are high in salt tolerance. Good soil drainage is required for sunflower production, but this crop does not differ substantially from other field crops in flooding tolerance. V. Cultural Practices: A. Seedbed Preparation: Many different tillage systems can be used effectively for sunflower production. Conventional systems of seedbed preparation consist of moldboard plowing or chisel plowing to invert residue and several secondary field operations. Conventional systems have been shown to increase the availability and improve the distribution of potassium and nitrogen and to increase the seed zone temperatures. However, the risk of erosion and expense of the several tillage operations has led to greater interest in minimum or ridge tillage systems. Both germination percentage and lodging have been shown to increase in ridge-till systems vs. level plantings
Ravimainete ja nende metaboliitide jääke söövad inimesed küll väga väikestes hulkades, kuid selle eest pidevalt. Seetõttu võivad nad pikas perspektiivis inimtervisele ohtlikud olla. Kaua aega ei pööratud sellele probleemile erilist tähelepanu. Viimasel ajal on paika pandud vastavad ooteajad, kontrolli ja seire süsteemid, moningatele ka EL ja Codex Alimentariuse komisjoni poolt kehtestatud maksimaalsed lubatud piirnormid (MRL = maximum residue limit) g/kg või mg/kg toidutoorme kohta. Vaatleme lähemalt mõningaid olulisemaid veterinaarravimite rühmi. · Antibiootikumid parandavad toitainete omastatavust, kiirendades sellega loomade (vasikad, sead, lambad, linnud, kalad) kasvu. Jääke leidub nii vastavate loomade lihas kui ka piimas ja linnumunades. Pidev pikaajaline tarvitamine, ka madalates doosides, tekitab riski
Tenderness embodies all the mouth medius (round), have higher levels of heme feel characteristics perceived kinesthetically: iron and/or myoglobin (Yancey et al. 2006). those perceived prior to mastication (particle Compared with beef Infraspinatus, Psoas size, oiliness), during mastication (tender- major, and Rectus femoris, the Gluteus ness, juiciness), and after mastication (fibrous medius had the highest liver off-flavor score residue, mouth coating; Bourne 1992). (Stetzer et al. 2007). Of the Complexus, Tenderness is composed of mechanical Serratus ventralis, Vastus lateralis, Vastus (hardness, cohesiveness, elasticity), particu- medialis, and Longissimus dorsi, the Vastus late (grittiness and fibrousness), and chemi- lateralis had the highest liver off-flavor score cal components (juiciness and oiliness; and the Longissimus dorsi had the lowest Bourne 1992)
d) For non-mining minerals up to 30 years; e) For underground water and natural non-fuel gases up to 25 years; f) For construction of buildings not related to extraction of minerals up to 45; g) For exploration of minerals up to 5 years. (The Law on Minerals, Article 10, Paragraph 2) In a case when an application for a mineral use license implies the construction of special places for storing hazardous substances and residue, or the exploitation of underground facilities of dif- ferent types related to development of a social infrastructure, and is of a special State importance, the license of use is issued for an indefinite time. Similar to oil and natural gas, ownership of mineral rights belongs only to the State regardless of the owner of the plot of land. 71
These considerations suggest that reducing the redundancy will hinder cryptanalysis. Shannon himself prescribes operating on the plaintext "with a transducer which removes all redundancies. . . . The fact that the vowels in a passage can be omitted without essential loss suggests a simple way of greatly improving almost any ciphering system. First delete all vowels, or as much of the message as possible without running the risk of multiple reconstructions, and then encipher the residue." Experts who have attacked cryptograms from whose plaintexts only the letter e has been eliminated have found that the difficulty of solution increased noticeably. Reducing redundancy is especially effective because it robs the cryptanalyst of one of his chief tools for attack instead of just bolstering the wall of secrecy. Cryptographers of the Italian Renaissance did this when they ordered cipher clerks to drop the second letter of a doublet, as the second / in sigillo.
annaabi.ee 
