Võrrelda tulemusi. 2. DNA järjestuste fülogeneetiliste puude arvutamine kasutades erinevaid fülogeneetiliste puude koostamise programme. a. Leida geeni rrsH (KEGG, iseloomustada lühidalt) järjestused järgmistele organismidele: 1. Escherichia coli K12 MG1655 2. Escherichia coli O157 EDL933 3. Salmonella typhimurium LT2 4. Shigella flexneri 301 5. Salmonella enterica serovar Paratyphi A b. Sooritada antud järjestuste MSA kasutades mõnda programmi (näiteks ClustalW, EBI). c. Moodustada nende järjestuste jaoks fülogeneetilised puud kasutades erinevatel arvutusmeetoditel (kaugusmeetodid, MP, ML) baseeruvaid fülogeneetiliste puude koostamise programme PHYLIP paketis (http://evolution.genetics.washington.edu/phylip.html, tutvuda programmide
E22] ref|ZP_00736248.1| COG0149: Triosephosphate isomerase [Escherichia coli 53638] ref|ZP_00921264.1| COG0149: Triosephosphate isomerase [Shigella dysenteriae 1012] ref|ZP_00924873.1| COG0149: Triosephosphate isomerase [Escherichia coli 101-1] Length=249 96% sarnasus esines: Järelikult Salmonella vastava valgu järjestus pole täpselt identne võrreldud järjestusega, kuid on väga sarnane. ref|YP_153001.1| triosephosphate isomerase [Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150] ref|YP_001591179.1| hypothetical protein SPAB_05055 [Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7] ref|ZP_02349944.1| hypothetical protein Sententeri_08764 [Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853] ref|ZP_02652409.1| hypothetical protein Sententeric_15496 [Salmonella enterica subsp. enterica serovar Javiana str. GA_MM04042433] ref|ZP_02701262.1| hypothetical protein Saentericaenterica_24714
gggaactcaaaggagactgccagtgataaactggaggaaggtggggatgacgtcaagtca tcatggcccttacgaccagggctacacacgtgctacaatggcgcatacaaagagaagcga cctcgcgagagcaagcggacctcataaagtgcgtcgtagtccggattggagtctgcaact cgactccatgaagtcggaatcgctagtaatcgtggatcagaatgccacggtgaatacgtt cccgggccttgtacacaccgcccgtcacaccatgggagtgggttgcaaaagaagtaggta gcttaaccttcgggagggcgcttaccactttgtgattcatgactggggtgaagtcgtaac aaggtaaccgtaggggaacctgcggttggatcacctcctta 5. Salmonella enterica serovar Paratyphi A http://www.genome.jp/dbget-bin/www_bget?spt:SPA0256 Kristina Raud YAGB-41 060290 >spt:SPA0256 rrsH; 16S ribosomal RNA; K01977 16S ribosomal RNA (N) aattgaagagtttgatcatggctcagattgaacgctggcggcaggcctaacacatgcaag
tion run-off fluids (Skandamis et al. 2009). cides, as well as to other (heterologous) However, the role of acid adaptation on stresses (cross-resistance or protection). microbial resistance to decontamination Specifically, Sampathkumar et al. (2004) treatments possibly depends on the microor- found that pre-treatment of S. enterica ganism and product storage conditions, since serovar Enteritidis with sublethal levels of acid adaptation of L. monocytogenes did not TSP (i.e., 1.5%) increased tolerance to higher seem to affect the survival and proliferation TSP concentrations, and conferred cross- of the organism during storage at 10°C of tolerance to heat (55°C) and alkaline pH beef treated with hot water and/or lactic acid (11.0). However, evidence for such cross- (Ikeda et al. 2003). An additional concern is tolerance in situ is still lacking
annaabi.ee 
