Vajad kellegagi rääkida?
Küsi julgelt abi LasteAbi
Logi sisse
Sulge

"l37" - 2 õppematerjali

Molekulaarbioloogia protokoll
16
docx

Molekulaarbioloogia protokoll

>emb|AL359092.14| Human DNA sequence from clone RP11-57C19 on chromosome 9 Contains the 3' end of the FUBP3 gene for far upstream element (FUSE) binding protein 3, an ribosomal protein L19 (RPL19) pseudogene, the PRDM12 gene for PR domain containing 12, the gene for RRP4 (homolog of yeast RRP4 (ribosomal RNA processing 4) 3'-5' exoribonuclease), the 5' end of two variants of the ABL1 gene for v-abl Abelson murine leukemia viral oncogene homolog 1, a ribosomal protein L37 (RPL37) pseudogene and three CpG islands, complete sequence Length=173463 Score = 350 bits (189), Expect = 3e-93 Identities = 189/189 (100%), Gaps = 0/189 (0%) Strand=Plus/Minus Query 1 CCGCGGCAGGCCGACGGCCCCACGGAGGGACATTGAAGGGGAAGTGGAGGAGAAGAGCAG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 55971 CCGCGGCAGGCCGACGGCCCCACGGAGGGACATTGAAGGGGAAGTGGAGGAGAAGAGCAG 55912

Bioloogia → Molekulaar- ja rakubioloogia...
103 allalaadimist
Andmetöötlus 2-kodutöö-loogika- ja otsingufunktsioonid
333
xlsx

Andmetöötlus 2. kodutöö (loogika- ja otsingufunktsioonid)

N2 VOLVO FL612 N2 VOLVO FL612 N2 VOLVO FL612 N2 VOLVO FL612 N2 VOLVO FL612 N2 VOLVO FL612 N2 VOLVO FL612 N2 VOLVO FL612 N2 VOLVO FL612 N2 VOLVO FL612 N2 VOLVO FL612 N2 VOLVO FL612 N2 VOLVO FL612 N2 VOLVO FL612 N2 VOLVO FL612 N2 VOLVO FL612 N2 VOLVO FL614 N2 VOLVO FL614 N2 VOLVO FL614 N2 VOLVO FL616 N2 VOLVO L31543 N2 VOLVO L31543 N2 VOLVO L3164 N2 VOLVO L3164 N2 VOLVO L37 N2 VOLVO L385 N2 VOLVO L43012 N2 VOLVO LV 125 D N2 VOLVO N84 41 N2 VOLVO N84 44 N2 VOLVO N84 44 N2 VOLVO N84 47 N2 ZAZ 3507 N2 ZIL (MMZ-4502) N2 ZIL (MMZ-4502) N2 ZIL (MMZ-4502) N2 ZIL (MMZ-554) N2 ZIL (MMZ-554) N2 ZIL (MMZ-554) N2 ZIL (MMZ-554) N2 ZIL (MMZ-554) N2 ZIL (MMZ-554) N2 ZIL (MMZ-554) N2 ZIL (MMZ-554) N2 ZIL (MMZ-554) N2 ZIL 130 N2 ZIL 130

Informaatika → Andmetöötlus
7 allalaadimist


Sellel veebilehel kasutatakse küpsiseid. Kasutamist jätkates nõustute küpsiste ja veebilehe üldtingimustega Nõustun