Molekulaarbioloogia protokoll
CACCCCCGCGATGCGGCGGCTGAGAATGGAGCCCATGGTGCGCCGCGCTGCCGGGCAGAG
GGGCCAGGGCCGGAACGGGAGCGGCGACAGCGGCGGGGTCCTCA
Rohelised ja allakriipsutatud on Cfr421 saidid. Kollane "highlight" on inserdi järjestus.
DNA järjestuse võrdlemine andmepankades olevate tuntud järjestusega kasutades BLAST.
>emb|AL359092.14| Human DNA sequence from clone RP11-57C19 on chromosome 9
Contains
the 3' end of the FUBP3 gene for far upstream element (FUSE)
binding protein 3, an ribosomal protein L19 (RPL19) pseudogene,
the PRDM12 gene for PR domain containing 12, the gene
for RRP4 (homolog of yeast RRP4 (ribosomal RNA processing
4) 3'-5' exoribonuclease), the 5' end of two variants of the
ABL1 gene for v-abl Abelson murine leukemia viral oncogene
homolog 1, a ribosomal protein L37 (RPL37) pseudogene and
three CpG islands, complete sequence
Length=173463
Score = 350 bits (189), Expect = 3e-93
Identities = 189/189 (100%), Gaps = 0/189 (0%)
Strand=Plus/Minus