Vajad kellegagi rääkida?
Küsi julgelt abi LasteAbi
Logi sisse
Sulge

"homolog" - 1 õppematerjal

Molekulaarbioloogia protokoll
16
docx

Molekulaarbioloogia protokoll

Rohelised ja allakriipsutatud on Cfr421 saidid. Kollane "highlight" on inserdi järjestus. DNA järjestuse võrdlemine andmepankades olevate tuntud järjestusega kasutades BLAST. >emb|AL359092.14| Human DNA sequence from clone RP11-57C19 on chromosome 9 Contains the 3' end of the FUBP3 gene for far upstream element (FUSE) binding protein 3, an ribosomal protein L19 (RPL19) pseudogene, the PRDM12 gene for PR domain containing 12, the gene for RRP4 (homolog of yeast RRP4 (ribosomal RNA processing 4) 3'-5' exoribonuclease), the 5' end of two variants of the ABL1 gene for v-abl Abelson murine leukemia viral oncogene homolog 1, a ribosomal protein L37 (RPL37) pseudogene and three CpG islands, complete sequence Length=173463 Score = 350 bits (189), Expect = 3e-93 Identities = 189/189 (100%), Gaps = 0/189 (0%) Strand=Plus/Minus Query 1 CCGCGGCAGGCCGACGGCCCCACGGAGGGACATTGAAGGGGAAGTGGAGGAGAAGAGCAG 60

Bioloogia → Molekulaar- ja rakubioloogia...
103 allalaadimist


Sellel veebilehel kasutatakse küpsiseid. Kasutamist jätkates nõustute küpsiste ja veebilehe üldtingimustega Nõustun