Vajad kellegagi rääkida?
Küsi julgelt abi LasteAbi
Logi sisse
Sulge

"cttcatttgctgctaacccgctctactttgacccgaaaaacattgttgaactggcgatcg" - 1 õppematerjal

BIOinformaatika kodutöö 5
79
doc

BIOinformaatika kodutöö 5

-Combined concentration of K+ and Na+ in the reaction = 50 millimolar. -Mg+2 concentration in the reaction = 1.5 millimolar. -Primer concentration in the reaction = 200 nanomolar. 7) Restriction Digest Restriction Digest results >326 bp linear fragment from linear parent eco:b2097 fbaB, dhnA; fructose-bisphosphate aldolase class I [EC:4.1.2.13]; K01623 fructose-bisphosphate aldolase, class I (N), base 248 to base 573 (AluI ag|ct - AluI ag|ct). cttcatttgctgctaacccgctctactttgacccgaaaaacattgttgaactggcgatcg aagcgggctgtaactgtgtggcgtcaacttacggcgtgctggcgtcggtatcgcggcgtt atgcgcatcgcattccattcctcgtcaaacttaatcacaacgagacgctaagttacccga atacctacgatcaaacgctgtatgccagcgtggagcaggcgttcaacatgggcgcggttg cggttggtgcgactatctattttggctcggaagagtcacgtcgccagattgaagaaattt ctgcggcttttgaacgtgcgcacgag >256 bp linear fragment from linear parent eco:b2097 fbaB, dhnA; fructose-bisphosphate aldolase class I [EC:4.1.2.13]; K01623 fructose-bisphosphate aldolase, class I (N), base 574 to base 829 (AluI ag|ct - AluI ag|ct).

Informaatika → Bioinformaatika
46 allalaadimist


Sellel veebilehel kasutatakse küpsiseid. Kasutamist jätkates nõustute küpsiste ja veebilehe üldtingimustega Nõustun