"atgacagata" - 1 õppematerjal

BIOinformaatika kodutöö 5

ttatcagttagctaactgctatatgggtcgggctgggttgataaactccggcggtgctgc gggcggtgaaactgacctcagcgatgcagtgcgtactgcggttatcaacaaacgcgcagg cggaatggggctgattcttggacgtaaagcgttcaagaaatcgatggctgacggcgtgaa actgattaacgccgtgcaggacgtttatctcgatagcaaaattactatcgcctga 2) CpG Islands CpG Islands results Results for 1053 residue sequence "eco:b2097 fbaB, dhnA; fructose-bisphosphate aldolase class I [EC:4.1.2.13]; K01623 fructose-bisphosphate aldolase, class I (N)" starting "atgacagata" CpG island detected in region 3 to 202 (Obs/Exp = 1.18 and %GC = 50.50) CpG island detected in region 18 to 217 (Obs/Exp = 1.19 and %GC = 50.50) CpG island detected in region 21 to 220 (Obs/Exp = 1.19 and %GC = 50.50) CpG island detected in region 24 to 223 (Obs/Exp = 1.19 and %GC = 50.50) CpG island detected in region 25 to 224 (Obs/Exp = 1.19 and %GC = 50.50) CpG island detected in region 26 to 225 (Obs/Exp = 1.19 and %GC = 50.50) CpG island detected in region 27 to 226 (Obs/Exp = 1