lake. Soon a rainstorm starts, but luckily they get rescued by the Lake Warden before the island disappears under water. In the end the kids get permission to stay with Miss Williams for the rest of the summer and they do't have to return to Mrs.McCafferty I think the book was too predictable and a little bit boring for me, but younger readers will certainly enjoy it. For a children's book, I think it's great. Some of the phrases and words I find interesting: Porch veranda Leave someone stranded - kedagi hätte/kitsikusse jätma Catch sight of something - midagi korraks nägema Take a fancy to somebody - kedagi eelistama, kellegile meeldima hakama Beat someone to the punch midagi tegema enne, kui keegi teine seda teeb Have one's heart set on something midagi väga lootma, ihkama, tahtma
miRNA micoRNA, on lühikesed, keskmiselt 22 nukleotiidi pikad ribonukleiinhapped (RNA), mis esinevad eukarüootsetes rakkudes. MiRNAd on posttranskriptsioonilised regulaatorid, mis seonduvad messenger RNA (mRNA) transkriptide komplementaarsetele järjestustele. Tavaliselt on selle tagajärjeks translatsiooniline repressioon või märklaud-mRNA degradatsioon ja geeni vaigistamine. siRNA - väike interfeeriv RNA, osaleb transkriptisoonijärgses geenide vaigistamises. Is a class of double-stranded RNA molecules, 20-25 base pairs in length. siRNA plays many roles, but its most notable is in the RNA interference pathway, where it interferes with the expression of specific genes with complementary nucleotide sequence. The process of RNA interference can be moderated by either siRNA or miRNA, but there are subtle differences between the two.. siRNA is considered exogenous double-stranded RNA that is taken up
When you're loving me, I'm loving you And that's when we've got it goin' on. So many people think we've got it wrong They all try to break us but we won't play along So let's get down and dirty baby Let's get restless baby, come on get crazy with me. And I said When you're loving me, I'm loving you I love the prowess in the things that you do And it's your flawless soul that bleeds my stone When you're loving me, I'm loving you And that's when we've got it goin' on, oh goin' on. I was so stranded I was lost and abandoned I needed another home You fly in my arms, you just fly right into my arms. When you're loving me, I'm loving you I love the prowess in all the things that you do And it's your flawless soul that bleeds my stone And when you're loving me, I'm loving you And that's when we've got it goin' on. When you're loving me, I'm loving you And I love the prowess in all the things that you do And it's your flawless soul that bleeds my stone When you're loving me, I'm loving you
This is the perfect location for leisure, as well as special events such as team building and business functions. The story of Wild Wadi all began with a cool dude called Juha and his brave friend Sinbad. One day as they were returning from one of their adventures, they were suddenly caught up in the mother of all storms. Somehow Juha, his family, Sinbad, the entire crew and even Juha's donkey managed to survive. They found themselves stranded on a beautiful lagoon, surrounded by mountains and all sorts of exotic plants and wild life. So the kids came up with new ideas to have fun. They asked the crew to redirect the streams and create waterfalls and water slides. Then they used palm leaves to build rafts, which they sat on and floated downstream. And when they tired of that, they simply threw themselves into the rushing water and had a great time. Pretty soon others were drawn to
T568-B-OV, O, RV,S, SV, R,PV, P. Otsekaabel(Straight cable)-mõlemad otsad sama standardi järgi, , kasutatakse juhul, kui seadmed oskavad pordisiseselt saatjaid ja vastuvõtjaid ümber pöörata, ristkaabel(Crossover cable)-üks ots on A, teine on B kasutatakse juhul, kui ei osata pöörata, SOLID CORE-tahke tuum, jäik, koosneb ühest kiust,kasutatakse kohtades, kus kaablid ei liigu ja ei painutata STRANDED CORE-keerutatud kimp,koosneb mitmest kiust, pehmem, kasutatakse seal, kus on vaja kaablit kokku kerida, lahti võtta vms kohtades SHIELDED-varjestatud UN SHIELDED-varjestamata TP-keerupaar · Signaali modulatsioon-osapooled tekitavad signaale omavaheliseks suhtlemiseks, signaalist arusaamiseks kasutatakse abisignaale.Taktsagedus-süsteemikell, ülesandeks on väga täpse vahega genereerida signaali impulssi
to an end and as a way to cope with her own bleak life. She starts to hand out with Sam more often, after her mother left the family for a butcher. Sam Lowbridge is the head of the motorcycle gang. In the novel there is an episode in which Sa mis verbally abusive of Indian people, which hurts and embarasses Meena. Sam is aware of the fact that, like many others of his white working-class peers in his village, hei s stranded in the demising Tollington without a fair chance finding employment. As a social outcast, there is no useful palce for Sam in the society that has rejected him. Given his racist opinions, he feels betrayed in view of the opportunities in store for Meena. These feelings are of course augmented by Meena playing with his attraction to her, whereby she underscores her position of relative power. Sam bring people under his sway by bullying them.
• With pre-version-1 CPU Units, be sure to attach the supplied labels when wir- ing in order to prevent wiring cuttings from entering in the Unit. • Remove the label after the completion of wiring to ensure proper heat dissipa- tion. Leaving the label attached may result in malfunction. • Use crimp terminals for wiring. Do not connect bare stranded wires directly to terminals. Connection of bare stranded wires may result in burning. • Double-check all the wiring before turning on the power supply. Incorrect wir- ing may result in burning. • Be sure that the terminal blocks, expansion cables, and other items with lock- ing devices are properly locked into place. Improper locking may result in mal-
4 if cut with sticky ends then join; 5 if cut with blunt ends then, sticky ends / nucleotides, added; R bases 6 with C bases one end and G bases other; 7 requires terminal transferase; 8 (DNA) ligase needed to seal nicks in DNA backbone; 9 ref to join phosphate - sugar / adds phosphate; 10 DNA may be produced by reverse transcriptase; 11 from mRNA; 12 single strand made double stranded by DNA polymerase; 13 wanted DNA replicated by polymerase chain reaction (PCR); 14 using, DNA polymerase with high optimum temperature /Taq polymerase; 15 AVP; max 8 QWC - clear, well-organised answer using specialist terms; 1 award QWC mark if three of the following are used endonuclease terminal transferase
The syntactic roles: - Premodifiers of nouns - Subject complement - Postmodifiers of nouns: - Object complement Adverb phrases : so slowly, fortunately enough - Modifiers in adjective or adverb phrase - Adverbials on the clause level Prepositional phrase: PPs consist of a preposition and a complement (typically a NP, sometimes wh-clauses and ing-clauses). in the evening Functions: - Adverbials on the clause level - Postmodifer and complement of nouns - Complement of adjectives stranded prepositions: Susan understood what he was aiming at. What did you ask for? - in interrogative clauses, relative clauses, passive constructions, infinitival complement clauses, and ing-clauses. Clause structures: subject (S) verb (V) object (O) direct (Od) indirect (Oi) complement (C) subject complement (Cs) object complement (Co) adverbial (A) subject-related (As)
redigeerimine jne. d. Leida nukleotiidide sisaldused, ORF-d, komplementaarsed järjestused, restriktsioonikaardid. Transleerida erinevates raamides, leida aminohapete sisaldused, luua erinevaid hüdrofoobsus ja fiilsus profiile. Nukleotiidide sisaldused: DNA molecule: gi|24648965|ref|NM_142773.1| Drosophila melanogaster CG7069-RA (CG7069), mRNA Length = 2693 base pairs Molecular Weight = 818782,00 Daltons, single stranded Molecular Weight = 1636219,00 Daltons, double stranded G+C content = 48,05% A+T content = 51,95% Nucleotide Number Mol% A 880 32,68 C 551 20,46 G 743 27,59 T 519 19,27 ORF: >gi|24648965|ref|NM_142773.1| Drosophila melanogaster CG7069-RA (CG7069), mRNA ATGTTCCACTTGCCTGTTAAACCTAAGATATCGCTGCTATGCCAGCAAATGCAAGAAA
§ Neid omadusi kombineeritakse replikatsiooni iseärasustega. Tulemuseks on nn. Baltimore klassifikatsioon (vt. allpool). Iga viiruse replikatsioonistrateegia sõltub selle viiruse geneetilisest materjalist. Selles mõttes jaotatakse viirused replikatsioonistrateegia alusel seitsmesse rühma. Replikatsiooni strateegiad § Edukaks replikatsiooniks peab viirus esitlema makroorganismi rakule mRNA, mille rakk muudab viiruslikeks valkudeks. Selle teostamiseks: § d/s DNA (double stranded DNA) - vabastab oma genoomi tuuma ja kasutab rakuaparaati sünteesiks; § RNA (+) - omab genoomi, mis käitub vahetult mRNA-na (v.a. retroviirused!); § RNA () - peab sisaldama viiruslikult kodeeritud ensüüme RNA-st sõltuva RNA replikatsiooniks. Nakatamata rakul need ensüümid puuduvad! RNA genoomiga viirused § Imetaja rakud ei sisalda RNAst sõltuvat RNA polümeraasi § RNA viirused kodeerivad RNA-st sõltuvat RNA polümeraasi §
erinevate krooniliste haigustega isikutel (kasvajad) ning vanematel inimestel. Kui tuumavastased antikehad on kõrges tiitris, seostuvad need SEL ning teiste süsteemsete sidekoehaigustega ja ANA alatüübid on nende haiguste diagnostiliseks markeriks. Süsteemse erütematoosse luupuse diagnoosi vastu on negatiivne ANA. SEL patsientide seerumis esineb kolme tüüpi anti-DNA antikehasid: anti-single stranded e denature-DNA (=anti-ssDNA) anti-double stranded e native DNA (= anti-dsDNA) reageerivad nii ss-DNA-ga kui ds-DNA-ga dsDNA väga spetsiifiline SLE-le. dsDNA autoantikehade määramiseks kasutatakse testi Crithidiae luciliae. Antikehad võivad olla nii IgG kui ka IgM klassist. Üheks oluliseks tunnuseks SLE haigetel on anti-dsDNA antikehade esinemine kõrges tiitris. anti-dsDNA antikehad esinevad 70% aktiivse luupusega haigetest. Positiivse testi spetsiifilisus on 95%. Anti-RNP – 30-50% patsientidel eeskätt
9 police officer 3 I asked him if/whether he had 5 1 documented 5 ensured 10 mystery seen the robbery. 2 compelled 6 torpedoed 11 most important 4 I asked him how much money the 3 epitomised 7 inherited 12 request robbers stole/had stolen. 4 stranded 13 investigation 5 I asked him if/whether it was a 14 manager/head Challenge! frightening experience. 15 cause/set off Students' own answers 6 I asked him if/whether it was the
Seda terminit kasutatakse Drosophila ja Ceanorabditis'e uurijate poolt. Kuna see lühend on RNA vahendatud geeni vaigistamise nähtuse tähistamiseks kasutatavatest kõige lühem, siis eelistan kasutada just RNAi'd. PTGS - post-transkriptsiooniline geeni vaigistamine (silencing). Kasutatakse taimede puhul. Kasutatakse ka lühendit PTGS/RNAi. quelling - sama tähendusega termin Neurospora puhul. (quelling Ingl. k. - lämmatama, maha suruma) dsRNA - kaheahelaline RNA (double stranded) on RNAi oluline vahendaja. RdRP - RNA sõltuv RNA polümeraas suunab RNA sünteesi RNA matriitsi alusel, mille tulemuseks on dsRNA. See ensüüm ei ole RNAi toimumiseks vajalik kui rakus on suur kogus dsRNA'd. RNaas III - dsRNA spetsiifiline endoribonukleaas, mis hürdolüüsib rohkem kui 10 aluspaarise dsRNA fosfodiestersidemed. RNAi puhul toimub pikkade dsRNA'de lagundamine väiksemateks fragmentideks (21-25 aluspaari), mida viivad läbi RNaas III
funktsioneerimise. Uurib füüsikalis-keemiliste struktuuride ja biokeemilis-füsioloogiliste funktsioonide vastavust. Teadussuund hakkas arenema pärast makromolekulide ruumilise struktuuri kindlakstegemist (DNA 3-ruumiline struktuur). Molekulaarbioloogia dimensioon – 1 A – 300 A (üle 500 – rakubioloogia, alla 1 - biofüüsika) 1 A (ongström) = 10 -10 m 1nm = 10 A 2-ahelalise DNA läbimõõt – 20 A kovalentne side – 1,5 A globulaarse valgu d – 50 A dsDNA (double stranded) d – 50 A ribosoomide, valgumolekulide d – 200-300 A DNA aluspaaride vahe – 3,4 A vesiniksideme pikkus – 3 A nukleosoom – 60x110x110 A bakteri ribosoom – 200x200x230 A tuumapoorid – 120x120x75 A bakteriaalne RNA polümeraas – 90x90x60 A Molekulaarbioloogia põhidogma DNA↔ RNA →valk DNA sünteesitakse nii DNA kui RNA alusel! RNA-sõltuv DNA polümeraas – pöördtranskriptaas – revertaas – katalüüsib DNA sünteesi RNA matriitsilt, leiti algselt retroviirustelt.
simple, versatile, sensitive, specific, and especially using the real-time (RTi-) PCR that reproducible technique (Saiki et al. 1988). It allows the quantification of the initial amount is an in vitro exponential amplification of a of the template by tracking the reaction cycle- DNA fragment, and its principle is similar by-cycle. Another quantitative approach, to the mechanism of DNA replication. The competitive PCR, can be used when the PCR double-stranded DNA is first denatured, and product from the sample is compared with the two strands of single-stranded DNA are internal standards of known concentrations. duplicated using PCR primers that specifi- It coamplifies the target sequence and one cally anneal to these strands and are elon- competitor sequence (so-called internal stan- gated through the activity of DNA polymerase. dard) in a single reaction using conventional
settings and believable, down-to-earth characters. It is a "feel-good" movie that communicates a sense that the filmmakers like people and believe that though they are complex and troubled, they are basically good and are capable of change. T h e audience has the identification and satisfaction of cheering for the underdogs. T h e film has a visual inventiveness that employs many poetic touches like the image of Dave and Gaz stranded in a canal on a sinking abandoned car as Gaz's practical son Nathan scampers away on the bank. Meanwhile the multilayered plot, telling little stories about six men and a boy, is organized into a coherent dramatic experi ence by the use of Hero's Journey motifs and devices. By their actions within this framework, these ordinary men are transformed into heroes for the edification and enjoyment of the audience. A n d because of the universal recognition of the Hero's
annaabi.ee 
