"none" - 210 õppematerjali

Indefinite pronouns

Indefinite Pronouns Table of Contents Some and any....................................................................... 2 No (+ Noun) and none (+ Pronoun) ........................................ 3 Every and each..................................................................... 3 Whole ................................................................................... 4 Both, either and neither ....................................................... 4 Few/a few – a little/little....................................................... 5 A lot of/lots of – much/many................................................ 5

W11 Homework Solutions

Using Google, you found four possible circuits to use. These four circuits are shown in the below Figure. A B. . C. D. Which circuit will you use that can satisfy all given specifications? Justify your answer. Solution: Specifications state (with circuits adhering in square brackets):  ESD protection(high and low swing)[A,C] (B diodes wrong way around, D none)  ESD rise time limiting [C] (all others no series resistor)  Flyback protection [B,C] (others has none)  Release time max 2.2ms [B,C] (others has none, p. 139 table, more than 6V yback) The only circuit that satisfies all specifications is C.

Muusika alased mõisted

pkg:name="/word/webSettings.xml" pkg:contentType="application/vnd.openxmlformats- officedocument.wordprocessingml.webSettings+xml">< w:div w:id="1085103135">

TTÜ mõõtmise Töö nr. 5 nimetusega „Digitaalostsillograaf“

1 = 3,42 2 = 2,25 3 = 1,36 Sumbuvustegur on = ln(1 ÷ 2 ) = ln(3,42 ÷ 2,25) 166,67 = 69,79 Signaali kirjeldava avaldise valem on = 1 - ( + ) x on hälve tasakaaluasendist, t on aeg, algfaas = 0 Omavõnkesagedus on 0 = = 166,67 Sumbuva võnkumise sagedus = 02 - 2 = 166,672 - 69,792 = 151,35 Signaali kirjeldav avaldis on = 3,42 -69,79 (151,35 ) Signaalid RS232 liideses Väljastasin arvuti COM1 porti siglaani hüperterminali programmist parameetriga 9600, 7, none, 2, none. Signaaliks oli sümbol ,,f", mille ascii kood on 1100110. Kood väljastati kujul 0011001. Pinge põhjast tippu on - = 22,34 . 1 biti pikkus on 0,10 .

BIOinformaatika kodutöö 5

ct). atgacagatattgcgcagttgcttggcaaagacgccgacaaccttttacagcaccgttgt atgacaattccttctgaccag 8) Restriction Summary Restriction Summary results doesn't cut cuts once cuts twice cuts three times Results for linear 1053 residue sequence "eco:b2097 fbaB, dhnA; fructose-bisphosphate aldolase class I [EC:4.1.2.13]; K01623 fructose-bisphosphate aldolase, class I (N)" starting "atgacagata" Site: Positions: AatI agg|cct none AatII gacgt|c none Acc16I tgc|gca 15, 372, 567 AccII cg|cg 114, 361, 482, 933 AccIII t|ccgga none AclI aa|cgtt none AcvI cac|gtg none AfaI gt|ac 170, 913 AfeI agc|gct none AflII c|ttaag none AgeI a|ccggt 662 AhlI a|ctagt none

Maailmausundite statistika

Hadith (growing) Bhagavad- 1500 BCE with Gita, 13% Hinduism truly ancient 950 million Upanishads, (stable) roots & Rig Veda No religion 12% - None 775 million (Note 1) (dropping) Chinese folk 270 BCE None 390 million 6% religion The Tripitaka (consisting of the Vinaya, 350 - 1,600 6% Buddhism 523 BCE the Sutras, million (2) (stable?) and the Abhidharma) Tribal

A few and few, a little and little

· Few people visited him in hospital (= he had almost no visitors) · He had little money (= almost no money) Some adjectives and adjectival phrases can only go with uncountable nouns (salt, rice, money, advice), and some can only go with countable nouns (friends, bags, people). With Uncountable Nouns With Both With Countable Nouns How much? How much? or How many? How many? a little no/none a few a bit (of) not any a number (of) some (any) several a great deal of a lot of a large number of a large amount of plenty of a great number of a large quantity of lots of a majority of Some is used in positive sentences. Any is used in negative sentences.

Cisco sertifikaadid

võrgupõhiseid kõnelahendusi CCIE sertifikaat CCIE - Cisco Certified Internetwork Expert CCIE sertifikaadi taotlemiseks ei ole vajalik madalamate tasemete sertifikaatide omamine Näitab sertifikaadi omandanud spetsialistide väga kõrget taset Certification Paths Associate Professional Expert (CCIE) Routing & Switching CCNA CCNP CCIE Routing & Switching CCNA & Design CCDA CCDP None Network Security CCNA CCSP CCIE Security Service Provider CCNA CCIP CCIE Service Provider Storage Networking CCNA none CCIE Storage Networking Voice CCNA CCVP CCIE Voice Õppimisvõimalused Eestis IT Kolledz Tallinna Majanduskool Viljandi Ühendatud Kutsekeskkool Audentese Ülikool Tartu Ülikool Tapa Gümnaasium TLÜ Haapsalu Kolledz Tartu Kutsehariduskeskus

Astmelised laadilehed

Teksti omadused word-spacing Määrab ruumi sõnade vahel. Mõõdetakse punktides (pt), tollides (in), sentimeetrites (cm), pikselites (px), protsentides (%). letter-spacing Määrab ruumi tähtede vahel. Mõõdetakse punktides (pt), tollides (in), sentimeetrites (cm), pikselites (px), protsentides (%). text-decoration Märgib teksti dekoreerivaid elemente. Võimalikud väärtused: none, underline, overline, line-through, blink. Kui näiteks soovitakse kuvada allajoonimata linke tuleks CSS'i kirjutada järgmine rida: A:link, A:visited, A:active { text-decoration: none } vertical-align Märgib teksti vertikaalset joondust. Võimalikud väärtused: baseline, sub, super, top, text-top, middle, bottom, text-bottom. Võimalik on määrata ka protsentides.

Hepatiidi liigid

Ahepatiidiga, sest levib samuti saastunud käte ja toiduga. Kõige sagedamini haigestuvad 1540aastased mehed, kuid kõige ohtlikum on see rasedatele, sest võib põhjustada fataalset verejooksu raseduse lõpukuudel. Lootele endale ohtu pole. Peiteperiood kestab 1565 päeva. Haiguse tavalised avaldused peale kollasuse on palavik, kõhuvalu, oksendamine, isutus, liigesvalud. Vaktsiini Ehepatiidi vastu kahjuks veel ei ole. Õnneks ei lähe Ehepatiit krooniliseks.  NonA, nonB, nonC, nonE hepatiidid NonA, nonB, nonC, ja nonE hepatiidid avalduvad sarnaselt teiste hepatiitidega ja diagnoosida on võimalik vaid muude põhjuste väljalülitamise teel. Võib arvata, et osale nendest haigustest leitakse spetsiifiline tekitajaviirus. Ravi sümptomaatiline.  Pildid Ahepatiidi viirus Chepatiidi viirus  Kasutatud kirjandus http://www.omaklubi.net/t1772hepatiit

The Tudor Dynasty ( Tudorite dünastia) Powerpoint Show

Lordship of Ireland, later the Kingdom of Ireland. Its first monarch was Henry VII. Henry VII  THE TUDOR DYNASTY The Tudors extended their power beyond modern England, achieving the full union of England and the Principality of Wales in 1542 and successfully asserting English authority over the Kingdom of Ireland. They also maintained the traditional claims to the Kingdom of France, but none of them tried to make substance of it, though Henry VIII fought wars with France to try to reclaim that title. After him, his daughter Mary I lost the claim on France forever with the Fall of Calais.  THE TUDOR DYNASTY Henry VII Henry VIII Edward VI There were six rulers of Tudors Dynasty. Jane Grey Mary I Elizabeth I

Austraalia presentatsioon/ettekanne inglise keeles

AUSTRALIA  Facts of Australia Capital Canberra Population 22,603,709 Official language None National language ­ English Drives on the left Monarch Elizabeth II  Culture Australian culture has built up a valiant men of war Aboriginal culture: the rich and timeless tradition Australian English: speaking "Strine" Culture: Theatre, film, books and arts Nature Koalas Click to edit Master text styles Second level Third level Fourth level

BIOS

ühendatud kettaseadmete kohta (kõvakettad, CD-kirjutid, DVD-lugejad jne). Väikesätteks on Auto ­ see tähendab, et BIOS otsib ise ja automaatselt üles kõik 1. ja 2. ehk primaarse ja sekundaarse IDE-kanali külge ühendatud kettaseadmed. Seda muidugi vaid juhul, kui kettaseadmed on õigeati ühendatud (master/slave-sildadega määratud või cabel select´i hooleks jäetud). Teistest valikutest ­ None tähendab seda, et arvuti teab, et sellel kanalil kõvaketast ei ole (ning otsimiseks aega ei kuluta). User lubab kõik kõvakettaseaded ise täpsemalt paika panna. Kuid seda viimast läheb haruharva vaja, ning see eeldab ka mõningaid teadmisi kõvaketta ehitusest ja kõvakettajuhendi olemasolu või siis täpsemaid andmeid, mis on kõvaketta etiketilt maha kirjutatud. 3. Drive A:/B: See säte võimaldab valida paigaldatud disketiseadme(te) tüübi. Tüüpilised

Txt - Html Tabeli loomine

sisemised jooned). Need atribuudid paiknevad sama algtagis

. Nende väärtused on järgmised: frame = void ­ äärised puuduvad: = above ­ ülemine ääris; = below ­ alumine ääris; = hsides ­ ülemine ja alumine ääris; = vsides ­ vasak ja parem ääris; = lhs ­ vasak ääris; = rhs ­ parem ääris; = border ­kõik äärised; rules = none ­ sisemised jooned puuduvad; = rows ­ horisontaalsed jooned; = cols ­ vertikaalsed jooned; = all ­ kõik jooned; Näide 2. Teeme HTML - dokumendis järgmise tabeli: Tabelis puuduvad sisemised jooned ja on ainult alumine ja ülemine äärised. Selle tabeli HTML ­ kood on järgmine: none frame=hsides>

11

pptx

Inglisekeelne esitlus Indiast

Kolmas tase Neljas tase Viies tase  FREEDOM AND GOVERMENT Independence from the United Kingdom- 15th of August, 1947 President- Pranab Mukherjee Vice President- Mohammad Hamid Ansari Prime Minister- Manmohan Singh  POPULATION 1,210,193,422 (2011 census) Density 375/km2  AREA Total-3,287,590 km2 Water- 9.6 %  LANGUAGES Official languages- Hindi and English None national language Over 100 languages are spoken in India  CITYS Capital- New Delhi Largest city- Mumbai British India Capital- Kolkata  DATA Currency-rupee Drives on- left Polity-parliamentary republic  NATIONAL SYMBOLS Animal- tiger Bird- peacock Flower- lotos Tree- banyan tree Fruit- mango THANK YOU FOR ATTENTION!

Keeled → Inglise keel

2 allalaadimist

10

pptx

Australia - presentatsioon

Australia Helen Allik KÜG XB 2010 Commonwealth of Australia Capital ­ Canberra Political federation. Head of the state ­ Queen Elizabeth II. Head of the government ­ Julia Gillard. Offical language ­ none. National language - english. Physical geography A continent, an island and a country. Southern Hemisphere. Total area ­ 2,941,299 sq mi. Lowest point ­ Lake Eyre Highest point ­ Mount Kosciuszko Neighbours : Indonesia East Timor Papua New Guinea Vanuatu Solomon Islands Ned Caledonia New Zealand Mount Kosciuszko (2228 m) Click to edit Master text styles Second level

Keeled → Inglise keel

19 allalaadimist

8

doc

Referaat Aghata Christie eluloost ja teostest

· Sittaford Mystery, the (1931) · Peril at End House (1932) · Lord Edgware Dies (1933) · Murder on the Orient Express (1934) · Why Didn't They Ask Evans? (1934) · Three-Act Tragedy (1935) · Death in the Clouds (1935) · A.B.C. Murders, the (1936) · Murder in Mesopotamia (1936) · Cards on the Table (1936) · Dumb Witness (1937) · Death on the Nile (1937) · Hercule Poirot's Christmas (1938) · Appointment with Death (1938) · And Then There Were None (1939) · Murder is Easy (1939) · Evil Under the Sun (1940) · Sad Cypress (1940) · One, Two, Buckle My Shoe (1940) · Body in the Library, the (1941) · N or M? (1941) · Murder in Retrospect (1942) · Moving Finger, the (1942) · Death Comes as the End (1944) · Towards Zero (1944) · Sparkling Cyanide (1945) · Hollow, the (1946) · Taken at the Flood (1948) · Crooked House (1949) · Murder is Announced, a (1950) · Mrs. McGinty's Dead (1951)

Kirjandus → Kirjandus

18 allalaadimist

1

doc

Letter of complaint

Dear Sir/Madam, I'm writing to express my dissatisfaction with the service you offered to my friends and myself during our recent flight on the Eagle Airlines Flight 6048 from Gatwick to Rio de Janeiro on the 26th March at 10.35 pm. Firstly, when we got on the plane, the seats were so cramped that it was impossible to sit on them (although we were promised to travel in style and comfort) and the air stewards didn't even greet us. They sat in the corner and yawned. In addition to previous none of us didn't dare to use the toilets ­ toilets were filthy. We were told that during the flight it's possible to read free newspaper and enjoy feature film. At first there were no newspaper and secondly we could see only children's cartoon. Even though there were no children on the flight. Regrettably we were not happy with the ,,full meal with wine". We were offered only cold snacks. What's more, the air stewards were rude and unhelpful. Why do you promise friendly staff if you

Keeled → Inglise keel

106 allalaadimist

1

docx

Education

Education: Some people say that students should study only those subjects they are interested in Im going to discuss if students should study only those subjects they are interested in or not. Nowadays students are quite lazy and do not want to study or go to school. They think it is boring and parents work really hard to make them study. Also, a lot of students think that the majority of the subjects they are learning are pointless. But actually none of those are pointless and every thing has a reason. In addition to that, if students could choose the subjects themselves, then some classes would be really empty. For example, a lot of students do not like maths or reading. Math develops logic and then we could imagine how many people would be without logical thinking. And reading books enriches vocabulary, so if people do not read books at all, their vocabulary would be quite small.

Keeled → Inglise keel

14 allalaadimist

1

doc

How to write a formal letter? Kuidas kirjutada ametlikku kirja?

09.2008 Dear Sir Brown I'm writing for you because I'm dissatisfied about the success rate in this year's examinations. I read your report and it leaves me an explicit and clear message ­ the standards are falling and noone tries itselfs best anymore. Years ago it was very difficult to pass an exam, it was hard for us and only few of us could do it so I have to agree with your sayings. None of them worked hard I guess, they just walk in school from door to door and they think that they can just achieve theirs purposes like that. They need some experiences and things which can give them something to learn. In the future, they can't just celebrate and walk on air every day. They have to face difficulties and learn that somethimes there are hard times in everyone's life. Having done the exams and they're celebrating and being proud of themselves. There

Keeled → Inglise keel

278 allalaadimist

1

docx

What do scientists think about yetis?

footprints. The reason why report was so strongly supported and believable was because scientists noticed that no one would go up Himalayas and make a lie. One more report was sent from a team of hikers who climbed Mountain Everest. Most scientists believe the Yeti does not exist because there are no final results found yet to this answer. As to the evidence found by explorers that seems to support the existence of the yeti, none has yet help up to scientific investigation. Such as the footprints that were believed to be the ones of Yeti was left by bears. A skull was found but it was not the Yeti's but a goat. A fur that must have been the Yeti's skin was supposed to be a Blue bear's skin. Since these evidences are not as firm as always, it would be hard to tell the Yeti No. So far there are not much facts or evidences to be proven true.

Keeled → Inglise keel

4 allalaadimist

1

docx

Essay - The best things in life are free

The best things in life are free There is a saying that the best things in life are free. It's certainly true that money can't buy you happiness, but can you truly be happy if you don't have any money at all? On one hand, things like food, clothes and having a decent home to live in are quite essential to living a happy and normal life. These are basic needs that humans have, but none of those are free and they all cost money. But, for all that money is useful and good to have around, for all that it can buy, there are quite a few things that it can't buy. Money can't buy you thing like friends and family, love, health, knowledge and intelligence, and the list could go on and on. At the end of the day, these are the things that matter the most and this goes to show that the best things in life are really free. It's important to state that the saying can be either true or

Keeled → Inglise keel

36 allalaadimist

1

docx

Political parties in the US

programs. They believe, however, that many social programs are too costly to the taxpayers and that when taxes are raised to pay for such programs, everyone is hurt. They often accuse the Democrats of making the government too expensive and of creating too many laws that harm individual initiative. For that reason, Americans tend to think of the Republican party as more conservative. There are other, smaller parties in the United States besides the two major parties. None of these smaller parties, however, has enough popular support to win a presidential election. Americans do not have to join a political party in order to vote or to be a candidate for a public office. Whether or not they belong to a party, voters may cast ballots for any candidate they wish. Everyone votes in secret, and no one can know how another votes or force another person to vote for any particular program or candidate.

Politoloogia → Politoloogia

6 allalaadimist

1

docx

Bees

Most pollen is used as food for larvae. Bees have a long proboscis (a complex "tongue") that enables them to obtain the nectar from flowers. They have antennae almost universally made up of 13 segments in males and 12 in females, as is typical for the superfamily. Bees all have two pairs of wings, the hind pair being the smaller of the two; in a very few species, one sex or caste has relatively short wings that make flight difficult or impossible, but none is wingless. The best-known bee species is the European honey bee, which, as its name suggests, produces honey, as do a few other types of bee. Human management of this species is known as beekeeping or apiculture. Despite the honey bee's painful sting and the stereotype of insects as pests, bees are generally held in high regard. This is most likely due to their usefulness as pollinators and as producers of honey, their social nature, and their reputation for diligence

Keeled → Inglise keel

6 allalaadimist

2

docx

English story

didn’t have a clue what she wanted to do with her life. Although Sophia studied business management, she didn’t feel like this was what she wanted to do. Sophia loved cooking- she would wake up in the middle of the night just to bake a cake. When Sophia was 25, in her own apartment, with bachelor’s degree, with no work and no money, she decided that she had to do something with her life. She applied to every job she could find but unfortunately, none of them worked out. Sophia was about losing her last hope, then one night she saw a dream of her life five years later. When she woke up, it still seemed so real, so she decided to act just like she remembered from it. She wrote a business plan, went to the bank with it and luckily got loan for her own company. It was a cafe, which sells her bakeries! Step by step, this cafe started to become popular. Now, when Sophia is 40 years old, she is happy about all of the choices she has made

Keeled → Inglise keel

1 allalaadimist

1

docx

Test u 17 inglise keeles

7) Mary decided to challange herself and take part in the swimming competition. 2. ÜLESANNE ( sample answers ) 1) Would you like to go swimming tonight? ­ Yes, i'd love to. What time shall we go? 2) Do you fancy going to the theatre on Saturday? ­ Sorry, I'm afraid i can't. I'm looking after my little sister. 3) Do you want to play basketball this afternoon? ­ Thanks for asking me, but I'm studying for my history test. 3. ÜLESANNE 1) Tina and Ann do aerobics, but James doesn't. 2) None of them has/ have won an award. 3) All of them can speak a foreign language. 4) Ann went canoeing last year, but Tina and James didn't. 5) They are all intrested in helping the community. 6) Tina and James have been to a sports camp, but Ann hasn't. 7) James goes hiking every summer, but Tina and Ann don't. 4. ÜLESANNE 1) Arkansas 2) with her grandmother ( in Arkansas ) 3) African American female cable car conductor 4) worked as a waitress and cook / had to support herself and

Keeled → Inglise keel

9 allalaadimist

2

docx

Belling The Cat (Inglisekeelne luuletus koos tõlkega)

BELLING THE CAT The Mice once called a meeting to decide on a plan to free themselves of their enemy, the Cat. At least they wished to find some way of knowing when she was coming, so they might have time to run away. Indeed, something had to be done, for they lived in such constant fear of her claws that they hardly dared stir from their dens by night or day. Many plans were discussed, but none of them was thought good enough. At last a very young Mouse got up and said: "I have a plan that seems very simple, but I know it will be successful. All we have to do is to hang a bell about the Cat's neck. When we hear the bell ringing we will know immediately that our enemy is coming." All the Mice were much surprised that they had not thought of such a plan before. But in the midst

Keeled → Inglise keel

2 allalaadimist

2

odt

Computerised world – a better or a worse place to live in ?

Of course it is not the only negative thing, actually even students rely too much on computers, they copy their homework from the internet and find the answers just googling around in the web, which does not let them think by themselves and they do not have to search for the needed information all around textbooks, like they actually are supposed to. To sum up I would say that although computers have maybe made our life and the people too comfortable, still none of us could actually imagine the life in not computerised world. There is just too much good in it. It is like with any other thing- there is no good without bad.

Keeled → Inglise keel

3 allalaadimist

19

pptx

The Tudor Dynasty

Lordship of Ireland, later the Kingdom of Ireland. Its first monarch was Henry VII. Henry VII  THE TUDOR DYNASTY The Tudors extended their power beyond modern England, achieving the full union of England and the Principality of Wales in 1542 and successfully asserting English authority over the Kingdom of Ireland. They also maintained the traditional claims to the Kingdom of France, but none of them tried to make substance of it, though Henry VIII fought wars with France to try to reclaim that title. After him, his daughter Mary I lost the claim on France forever with the Fall of Calais.  THE TUDOR DYNASTY Henry VII Henry VIII Edward VI There were six rulers of Tudors Dynasty. Jane Grey Mary I Elizabeth I

Ajalugu → Inglise ajalugu

4 allalaadimist

10

pptx

England

· Bordered by Scotland in the north, the North Sea in the east, the England Channel in the south and Wales in the west. · Most of England is rolling hills. · Scafell Pike is the highest mountain in England with an elevation of 978 meters. Key Facts on England · Major Cities: London-Leeds-Liverpool-Manchester. · Capital: London with a population of 7,556,900. · Population: 51,446,000 inhabitants. · Geographic size: 130,395km². · National Anthem: None. God Save the Queen, Land of Hope and Glory. · Currency: Pound sterling (GBP). · Distribution: Males: 48,7% Females: 51,3%  Climate of England · England has a temperate climate, with mild winters with temperatures not much lower than 0 C, and not much higher than 32 C in summer. Generally, July is normally the warmest month, and February is normally the coldest. Religions in England

Keeled → Inglise keel

6 allalaadimist

2

docx

Beryl Bainbridge – “Master Georgie”

provide him with the prop he needed." His story is told by Myrtle, Dr Potter and Pompey Jones, who’s lives are changed by a sudden death of Hardy’s father in a brothel in Liverpool in 1846. The 4 characters don’t want to break Hardy’s moms heart so they want the fathers death to seem like he died calmly in his sleep. The following changes Myrtle’s, Dr Potter’s and Jones’s life completely. “At night all cats are grey”- Dr Potter “Likeness is none between us, but we go to the self-same end.”- George Hardy Hefty – Elation – Succumbing – Navvy – Utter – Suture – Hoarsely –

Keeled → Inglise keel

1 allalaadimist

2

docx

An example letter

National Museum of Physic Art. There were several aspects that I was sincerely dissatisfied with, and I hope that in the nearest future you will take steps to eliminate these faults. To begin with, I arrived at your museum at exactly 11.12, yet the ticket office was still closed even though according to the advertisement every door should have been opened by 11 o'clock. However, when I started to look for another gate or entrance, there were none at all. It seems that the front door of your museum is very difficult to find without a map. As for more, the staff working was extremely rude! I was trying to ask for my location and how to enter the museum but all I ever heard as a reply was insulting mumble and no clear sentences. Of course, that might have been rather understandable if we were talking about a fast food place, yet in such an official place as it is the National

Keeled → Inglise keel

7 allalaadimist

1

odt

Do you consider yourself more functionalist or more conflict theorist?

Do you consider yourself more functionalist or more conflict theorist? Please explain why? Functionalism and conflict theory are very different views of society, but they are not exactly opposites. Both have arguments, that make people think about the society they live in and both have theorists who critize each other. In my opinion, none of the theories are completely wrong but I do tend to agree with people on the conflict theory side. Firstly, functionalism ignores inequality and focuses too much on the positive functions in society. For example racism, functionalists will say that it must be imporant in order to exist as long as it has but in my opinion that sounds quite doubtful. The most problematic part about racism is above all the tension and conflict which comes with it

Sotsioloogia → Sissejuhatus...

1 allalaadimist

1

docx

Tess of the d'urbervilles

Tess of the D'Urbervilles - Guilty or Not? The story is about an ordinary young woman who encounters insurmountable obstacles but is responsible for creating none. From the beginning it can be understood that she doesn't have the right to express her opinion and if she had, would she dare to. It all begins with Tess following her father's wishes to make contact to the D'Urbervilles, because she has to manage to deal with an intrusive young man and because of her lack of experience she ends up being pregnant and alone. This kind of situation was not approved at her time and the villagers turned against her. When the baby was born and after a

Kirjandus → Inglise kirjandus

7 allalaadimist

2

doc

Inglise keele report: Animals in danger of extinction

the Galapagos Islands) , which is critically endangered, since there is only one remaining in existence. Tortoises on the Galápagos have been hunted for their meat by sailors and fishermen to the point of extinction. Also, the habitat of the tortoises has been eaten away by goats introduced from the mainland. There have been several attempts to breed the last representative of the species with similar tortoise varieties, but none of the eggs hatched. On the other hand, there is hope for the successful conservation of rare animals. A number of different international organisations have the same goal and work hard to protect both endangered wildlife and natural habitats. a) The World Wildlife Fund (WWF) has been protecting nature for already more than 45 years. WWF works in 100 countries and is supported by 5 million members globally. b) Animal Rescue Facilities provide homes for animals in need

Keeled → Inglise keel

34 allalaadimist

10

pdf

RS-liides ja modemid aruanne

Paarsuskontroll Mis muutus, kui Paarsus kontroll bit paarsuskontrolli viisiks seada inverteeris. Odd 3.2 Andmevahetus arvutite vahel nullmodemi abil Seadistus Seadistuse variant nr 1 Edastuskiirus 19200 Andmebittide arv 8 Paaritu Paarsuskontroll (odd) Stoppbittide arv 1 Puudub Voo juhtimine (none) Mõõtmised Paarsuskontroll ja Valitud sümbol ja Aeg esimese 0 nivoo algusest Mitu bitti selle aja edastatava sümboli valik sümboli ASCII kood kuni viimase 0 nivoo lõpuni jooksul edastati Odd, sümbolis "1" arv V (0110101) 464,0 mks 9 paaritu Edastuskiirus (bit/s): Edastus kiiruse arvutus: 9bit/464mks=19 390(bit/s) 3.3 Modemühendus arvutite vahel Andmeedastust ei toimu,

Informaatika → Side

41 allalaadimist

3

docx

Psychology – Gleitman

Result fits. Schizophrenics ofthe jump from one idea to another without maintaining firm line of thought. As a result their behavior often appears bizarre. It seems their extremely bizarre and morbid dreams are simply an exaggeration of a condition already present intheir waking life. Task of Psychology: What holds for dreams holds for most other psychological phenomena- they can all be viewed from several perspectives. Each perspective is valid but none is complete without the others, for psychology is a field of many faces and to see it fully, we must see them all. Wilhelm Wundt (Germany) and William James (USA)- founders. General Principles and Unique Individuals: Psychology's main purpose is not to describe the distinctive characteristics of a particular individual. Its main goal is to get at the facts that are general for all of mankind. Psychology hopes to find a route back to understand the individual event

Psühholoogia → Psühholoogia

22 allalaadimist

1

doc

The australian terrier

do not get along well with other adult male dogs Health There are three completed health surveys for Australian Terriers Two surveys, one in 1997 and one in 2002, have been conducted by the Australian Terrier Club of AmericaThe Club is currently collecting data for their next survey. The UK Kennel Club has a 2004 survey, but it has a much smaller sample size than the Australian Terrier Club of America surveys Some of the respondents in the American surveys were from Australia, but none of the Australian Terrier clubs in Australia appear to have conducted, or be in the midst of conducting, a survey.

Keeled → Inglise keel

3 allalaadimist

3

rtf

Internet- Otsimootor

Termini asukoht lehel Kahtlane Allintitle: kass all of these words: Allintext: kass this exact phrase: Allinhunt: kass any of these words: Allinancher: kass and none of these words: Domeeni valik ,,Ereli Laar" site:hansagymn.parnu.ee Pärnu Hansagümnaasium site:laar Kahtlane site:ereli Pildiotsing Ei ole Link Pildid > täpsem pildiotsing Üleval ribal Images Lisavõimalused Järjehoidja,töökeskkonna kujundamine Kalkulaator 100 cm in inches 5*9+ Kalkulaator: 102 = 8

Informaatika → Informaatika

18 allalaadimist

1

docx

The Importance of English History

northern part is too cold to live and the southern too warm. The inhabitants were cut off from any tribes that could support them and therefore had to survive on their own. As for more, soon invaders began to change the native population. The Celts, the Romans, the Vikings, then the Normandians ­ all wanted to live somewhere, gain power and finally, settle down. Since they were not the first ones to live in England, it was a little bit easier for them to adopt the new land, yet none of their rule lasted long enough to defeat British nature from toe to top. Even now some parts of England have inhabitants whose distant relatives and great-great-great...parents origin from the first ones to ever settle down on the island. To conclude, it could be said that the most interesting part of the history is watching the development of a nation and its life with the native nature. Both change through time, yet neither disappear nor surrender completely to another. The importance of

Ajalugu → British history (suurbritannia...

6 allalaadimist

11

doc

Trixbox virtuaalmasin ning IP PBX

suunatakse firma omaniku mobiili numbrile. Time condition name: Incoming Time to start: 08:00 Time to finish: 19:00 Week day start: Monday Week day finish: Sunday Nagu näha, tuleb paika panna ka reeglid, mis määravad seda, mida kõnega teha. Seda tuleb panna 'Digital Receptionist' => ,Add IVR' alt. Mina tegin kaks reeglit: · AfterHours (peale tööd) Name: AfterHours Timeout: 10 Enable Directory: linnuke peal Directory Content: Default Enable Direct Dial: linnuke peal Announcement: None · BusinessHours (tööajal) Name: BusinessHours Timeout: 10 Enable Directory: linnuke Directory Content: Default Enable Direct Dial: linnuke peal Announcement: None Ideeks on suunata kõned teisele numbrile määratud ajal. Et suunamine töötaks, peaks reaalselt toimima IAX2 protokoli konto, mis ühendab telefonijaama välisvõrguga. · Viimane asi, mida ma tegin, on ,outbound route'. Nimelt see on tee, mis ühendab minu telefonijaama teise maailmaga. Selleks ma tegin kontot

Informaatika → Kommunikatsiooniteenuste...

20 allalaadimist

6

doc

RS liides ja aeglased modemid - labor

Täitjad: Ahto Pärisalu 061956IATB Tanel Sarri 062382IATB Imre Tuvi 061968IATB Esitaja: Imre Tuvi 061968IATB Juhendaja: Aimur Raja Töö sooritatud: 24.10.2007 Aruanne esitatud: 17.11.2007 Aruanne tagastatud: ...........2007 Aruanne kaitstud: .............2007 1. Järjestikliidese RS-232C andmeülekande parameetrid ja ühenduste skeem klemmplaadil. Parameetrid: Port: COM2 Baud rate: 300 boodi Data: 7 bit Parity: even Stop: 2 bit Flow Control: none Transmit delay: 0 Ühenduste skeem 2. Signaalide RD ja TD skitseeritud ostsillogrammid kohaliku klaviatuur- ekraan andmevahetuse korral. Näidata ära edastatud bitijada vastavus saadud ostsillogrammidele. Joonisel on üks i. Joonis näitab negatiivset loogikat ehk ,,0" korral on kõrgepingenivoo. Bitijada: 0 1 0 0 1 0 1 1 1 (0 1 0 0 1 0 1 1 1 ) - esimene 0 on start-bitt

Informaatika → Side

116 allalaadimist

24

ppt

Bahamas

Island, Long Island,San Salvador Island, Acklins,Crooked Island, Exuma andMayaguana. Nassau capital city of The Bahamas, lies on the island of New Providence. Mount Alvernia(Como Hill) 63 metres (207 ft) on Cat Island.  Population: 309,156 Religions: Baptist 35.4%, Anglican 15.1%, Roman Catholic 13.5%, Pentecostal 8.1%, Church of God 4.8%, Methodist 4.2%, other Christian 15.2%, other Protestant 12%, none or unknown 3%, other 2% The 'other' category includes Jews, Muslims, Baha'is, Hindus, Rastafarians, and practitioners of Obeah Languages: English (official), Bahamian dialect Climate subtropical to tropical moderated significantly by the waters of the Gulf Stream the temperature can fall as low as 2­3 °C districts Acklins Crooked Island Berry Islands East Grand Bahama Bimini Exuma

Keeled → Inglise keel

5 allalaadimist

1

doc

Eclipse ´8th chapter(Temper)- kokkuvõte

Even the pack is sick of it. Bella starts to feel uncomfortable and suggests leaving. Jacob protests promising to be "her Jacob" from now on. They return to the house to and get he motorcycles to ride. After spending the afternoon riding they head to the garage to clean the bikes. Bella realizes she hasn't been there since Edward returned. Jacob recalls the last time Bella was there, which was Valentine's Day. Jacob asks Bella if she was serious about her change being none of his business. Jacob becomes angry and brings up the Cullens breaking the treaty. Bella then tells Jacob he already broe it by telling her about the vampires. Jacob tries to make Bella understand that she won't be Bella anymore once she is changed. Bella then tells him that it is only a matter of weeks before she changes. Enraged, Jacob tells Bella it would be better if she were dead. Bella, angry and hurt, takes off on her motorcycle and goes back to the Cullens. She sleeps

Keeled → Inglise keel

5 allalaadimist

2

docx

Paulo Coelho "The Alchemist"

Paulo Coelho ,,The Alchemist" ,,The secret of life, though, is to fall seven times and to get up eight times." ,,Everyone seems to have a clear idea of how other people should lead their lives, but none about his or her own." ,, Because I don`t live in either my past or my future. I`m interested only in the present. If you can concentrate always on the present, you`ll be a happy man. You`ll see that there is life in the desert, that there are stars in the heavens, and that tribesman fight because they are part of the human race. Life will be a party for you, a grand festival, because life is the moment we`re living right now."

Keeled → Inglise keel

18 allalaadimist

1

doc

Dover Beach

In the final stanza, the lover is addressed again. The author solemnly (a bit desperately even) makes an oath to always be true to her and expects the same from her. He explains this by stating that a world without faith is actually dark and complicated and says that what seems to be new and interesting and making our lives more comfortable actually pushes us further away from being in touch with our inner selves (faith) and holds none of the pleasures it seems to offer. In a world like that the only comfort he can find is in his lover and therefore does not want to lose her.

Kirjandus → Inglise kirjandus

6 allalaadimist

1

doc

The poor farmer's daugters

THE POOR FARMER'S DAUGHTERS Once upon a time there lived a poor farmer who only had seven children as his treasure. They were all girls, named after every famous queen the country had had. However, none of them was his child ­ they were all orphans, found in the nearby forest many years ago, during the Great War. The eldest one was Margaret; she had long dark shiny hair and big blue eyes. She was a true beauty compared to the other maidens at the village. However, she had a bad side as well ­ the only one she ever cared about was she herself. And when living at the county-side, being an egoist is not good. Lucia was the next. This year she would turn 16 if she hadn't played with a magical

Keeled → Inglise keel

3 allalaadimist

2

docx

Analysis of an article

Controversy: 2/10 The story hasn't brought up any conflicts (yet) and I do not believe that it will. It also received only one comment. But other news on this topic have caused arguments. Prominence: 0/10 There weren't any prominent and well-known people in this story, only some unknown scientists. Uniqueness: 7/10 In Estonia, this story is quite unique. Altough there are already companies selling vegan food and meat substitutes, none of them have created scientific foods that probably will have to feed the whole humanity in the future. The number of people involved or affected: 1/10; 10/10 At the moment, not too many people will be affected by it. In the future, I believe that most of us will. Human interest: 0/10 This is not a human interest story. Suspense: 0/10 In my opinion, this is not an exciting story. Used materials: Lakson, P. (2017)

Keeled → Erialane inglise keel

4 allalaadimist

4

doc

Agatha Christie romaanid

Ariadne Oliver 1937 Dumb Witness Hercule Poirot Arthur Hastings 1937 Death on the Nile Hercule Poirot Colonel Race 1938 Appointment with Death Hercule Poirot 1938 Hercule Poirot's Christmas Hercule Poirot 1939 Murder is Easy Superintendent Battle 1939 And Then There Were None 1940 Sad Cypress Hercule Poirot 1940 One, Two, Buckle My Shoe Hercule Poirot Chief Inspector Japp 1941 Evil Under the Sun Hercule Poirot 1941 N or M? Tommy and Tuppence 1942 The Body in the Library Miss Marple 1942 Five Little Pigs Hercule Poirot 1942 The Moving Finger Miss Marple 1944 Towards Zero Supenintendent Battle

Kirjandus → Kirjandus

85 allalaadimist

6

docx

Kairiru keel

2.4 Lause: Kairiru keeles on kahte tüüpi lauseid: nimi- või tegusõnaline. Nimisõnaline lause koosneb kahest nimisõnafraasist, kuid sellel puudub tegusõnafraas. Tegusõnaline lause koosneb tegusõnafraasist, aga võib sisaldada ka ühte või rohkemat nimisõnafraasi, mis ilmnevad tegusõna argumendina. Laused võivad olla kas sõltuvad või sõltumatud, liht- või liitlaused (Wivell 1981: 134). 2.5 Eitus: Kolm eitusvormi: ponoq, eipai `no, not, none` ja sapin `don´t, refrain from (hoiduma). Esinevad eitava lause lõpus (Wivell 1981: 162). 3. Foneetika ja fonoloogia 3.1 Foneemid: Kairiru keeles on:  15 kaashäälikut p, t, k, q, f, v, s, j, m, n, ñ, ŋ, l, r, ȓ  kaks poolvokaali: w, y;  viis täishäälikut i, e, a, o, u (Wivell 1981: 11). Näide kairiru keeles: yieq wurr quli - ny qo – laqa -i you (sg) banana skin 3sg 2sg-throw-3sg

Keeled → Keeleteadus

2 allalaadimist

Lahter 1	Lahter 2
Lahter 3