............................................................................................................4 Vere hüperviskoossuse patofüsioloogia...........................................................................4 Polütsüteemilise hüperviskoossuse sündroom.................................................................5 Erütrotsütoos................................................................................................................5 Hüperleukotsüütiline leukemia.................................................................................... 6 Sklerotsüteemilise hüperviskoossuse sündroom..............................................................7 Sirprakuline aneemia................................................................................................... 7 Hemolüütiline aneemia................................................................................................ 8 Plasmaatilise hüperviskoossuse sündroom.........
hüperplaasia, sobib lihakeha tarbimiseks • Seropositiivse veise liha käitlemisele kitsendusi ei kehtestata • Generaliseerunud kasvajalise leukoosi puhul kahjutustatakse kogu rümp ja siseelundid Esinemissagedus • 2012. a 3 juhtumit Võrumaal • 2011. a 1 juhtum Läänemaal • 2010. a 2 juhtumit – Lääne- ja Harjumaal • Kuulub teatamis-ja registreerimiskohustuslike loomataudide hulka Tekkepõhjused • Viirushaigus, tekitaja Retroviridae, Bovine leukemia virus • Peiteaeg 2-6 aastat • Krooniliselt kulgev • Vastuvõtlikud on igas vanuses veised, kliiniliselt avaldub vanemas eas • Ülekandumine: ninanõred, sülg, veri, in utero, iatrogeenne Diferentsiaaldiagnoosid • Sporaadiline leukoos • Tuberkuloos • Aktinomükoos • Kasvajad Inimesele ülekandumine • Haigelt loomalt – pole tuvastatud • Toore liha tarbimisel – pole tuvastatud • Töödeldud liha – ei levi Kasutatud kirjandus • Alaots, J., Saar, T
They both became closer to one another. Being the president of his school, Landon must find a date to the dance to fulfill his duties. After desperately searching for a date, he came to a conclusion that he had to ask Jamie Sullivan because there was no one left. Jamie accepts his proposal to the dance,. Landon slowly realises taht he has fallen in love with the most unlikely girl. After many dates, landon finally discovers that Jamie has terminal leukemia nd has stopped responding to treatment. Landon wants to fulfill Jamie's wish list example by building a telescope so she can see a comet. Trough this process, landon and jamie learn more about the nature of love. The book ends with Jamie's death, bus only after the couple are married in the same chapel as was jamie's deceased mother, the event that topped jamie'd wish list. "Love is like the wind. You can't see it but you can feel it"
drug addiction and alcoholism. Though she continued to perform, little was heard of her until 1987. In 1989 she signed with Island Records released the album Seven Year Itch. She has 30 studio albums, 3 live albums and 58 singles. She got married in 1969 to Artis Mills and was still married to him at her death. James had two sons, Donto and Sametto. Both started performing with their mother. In early 2011, she was diagnosed with leukemia. The illness became terminal and she died on January 20, 2012, just 5 days before her 74th birthday, at Riverside Community Hospital in California.
trombotsüütide ja erütrotsüütide ülekanne), sest hävib ka osa normaalseid vererakke, mille tõttu organism on vastuvõtlik infektsioonidele ja esineb verejooksuoht. 1. Terve veri ja leukeemia. (India Cancer Hospital) 2. Lumbaalpunktsiooni teostamine. (National Cancer Institute) 3. Luuüdiuuring, terve ja leukeemias luuüdi. (Pixshark) Kasutatud kirjandus 1. India Cancer Hospital, 2015 [WWW] 2. Pixshark, 2015 [WWW] http://pixshark.com/acute-lymphoblastic-leukemia-bone- marrow.htm 3. National Cancer Institute, 2015 [WWW] http://www.cancer.gov/cancertopics/pdq/treatment/childALL/Patient/page1 4. Kunnamo, I., jt. (1995) Üldarsti käsiraamat. Medicina, Tallinn 5. Keres, L., Sildver,L., Soo, T. (1986) Lastehaigused. Valgus, Tallinn 6. Eesti Leukeemia ja Lümfoomihaigete Liit, 2015 [WWW] http://www.leukeemia.ee/? page=5#hype1
ehk PBCV-1 MpV, CbV EsV, FsV SsRNA genoomiga viirused Ph. Retroviridae G. Alpharetrovirus RSV (Rous sarcoma v) G. Betaretrovirus MMTV (mouse mammary tumor v) G. gamaretrovirus MLV (murine leukemia virus) G. deltaretrovirus MTLV-1 (in.T-rakulise lümfooni v) G. epsilonretrovirus wall-eye dermal sarcoma virus G. Lentivirus HIV-1 HIV-2 SIV CAEV (caprine arthritis encephalit) FIV (feline immunodeficiency v)
Long time ago there lived a man who was the 35th president of the United States of America, his name was J. F Kennedy. He often refered to use his initials JFK. He was the yongest president, who has selected to be a president. But he was the president only 2 years, until his assassination in 1963. JFK was born in Brookline. JFK has moved a lot in his short lifetime. In 1935 he was hospitalized for two months of observation for possible leukemia. In 1940, Kennedy completed his thesis, ,,Appeasement in Munich", about British participation in the Munich Agreement. He initially intended his thesis to be private, but his father encouraged him to publish it. He graduated cum laude from Harvard with degree in international affairs in 1940, and his thesis was published that year as a book entitled Why England Slept, and became a bestseller. JFK was married with Jaqueline Bovier. Actually they had two sons, but one died on his first
3) Document type: valisin article 4) Source type: valisin journals 5) Language: valisin English Relevantsed artiklid: 1) Preliminary risk assessment of radon in groundwater: a case study from Eskisehir, Turkey 2) Prevention measures against radiation exposure to radon in well waters: Analysis of the present situation in Finland 3) Radon in drinking water and cancer mortality: An ecological study in Japan 4) Temporal changes in water quality at a childhood leukemia cluster 5) Health risk by radon in drinking and sanitary water: Assessment and control techniques 6) Kriging radon concentrations of groundwaters in western ardennes 7) Direct comparison of three methods for the determination of radon in well water 8) Childhood cancer mortality and radon concentration in drinking water in North Carolina 9) Naturally occurring radionuclides in drinking water: An exercise in risk benefit analysis
· Phoebe Holden's 10-year-old sister who is the most important person to him. Phoebe is intelligent and, despite her age, mature. She understands Holden better than anyone else. · D. B. Holden's older brother who is a writer and now works in Hollywood by writing movie scripts. Holden doesn't like it, saying that they don't leave anything for the writer's imagination in Hollywood. · Allie Holden's deceased younger brother, who died of leukemia years before Holden tells the story. Holden feels depressed and even guilty of his brother's death. He carries Allie's baseball glove around with him. 3. Main problem/conflict Holden is expelled from another school, Pencey Prep in Pennsylvania this time. He has been expelled from many school before. The school sent his parents a letter about their son dropping out from the school but since it would have taken a couple of days
· Takistavad proliferatsiooni, soodustavad onkogeeni, kaasneb pidev rakkude diferentseerumist, stimuleerivad apoptoosi (nt proliferatsioon. p53 ja pRB) 15. Krooniline lümfoidne leukeemia CML (chronic Myeloid 6. Miks tekivad kasvajarakkudes rakkude proliferatsiooni Leukemia )Translokatsoioon ja liitgeeni ning liitvalgu kontrolli häired. ( uudisvalgu) teke. Cleevec kui spetsiifiline liitvalgu bcr- · Proliferatsiooni reguleerivate valkude aktiivsus abl aktiivsuse inhibiitor kaob või on pärsitud. · On põhjustatud translokatsioonist 9-22 7
Embrüonaalsete tüvirakkude saamine · Laboris saadakse embrüonaalseid tüvirakke in vitro viljastamise teel. · Blastotsüstistaadiumis olevast embrüost eraldatakse sisemine rakumass, kasutades mehaanilist lahkamist ja immunokirurgiat. · Saadud sisemine rakumass pannakse kasvama abirakkudele ehk toiterakkudele. · Hiire embrüonaalseid tüvirakkse kasvatakse zelatiini juuresolekul, ning rakud vajavad leukemia inhibiitorfaktori (LIF) juuresolekut. Inimese embrüonaalsed tüvirakud vajavad toitepinda, mis koosneb hiire embroünaalsetest fibroblastidest (MEF) ja vajavad põhilise fibrobrasti kasvufaktori (bFGF) juuresolekut. · Diferentseerumise tekkimiseks eraldatakse embrüonaalsed tüvirakud abirakkudelt, et moodustuksid rakuklimbid, ehk embrüonaalsed kehad, kasutades selleks seerumit või muid diferentseerumist soodustavaid meetodeid.
Treatment advances in multiple myeloma, British Journal of Haematology, 125, 24-30. -43- 15) Barlogie B, Desican R, Eddelmon P. Extended survival in advanced and refractory multiple myeloma after single-agent thalidomide: identification of prognostic factors in a phase 2 study of 169 patients, Blood (2001) 98: 492-494. 16) Heinz L et al. Management of disease-related anemia in patients with multiple myeloma or chronic lymphocytic leukemia: epoetin treatment recommendations, the Hematology Journal (2002) 3: 121-130 17) Richardson P et al. A phase 2 study of bortezomib in relapsed, refractory myeloma, N Engl J Med (2003) 348: 2609-17 18) Jagannath s. et al. A phase 2 study of two doses of bortezomib in relapsed or refractory myeloma, British Journal of Haematology (2004) 127: 165-172 19) Harousseau J-L. Bortezomib in multiple myeloma: treatment approach and outcomes, EJC Supplements (2004) vol 2.6, 12-17
>emb|AL359092.14| Human DNA sequence from clone RP11-57C19 on chromosome 9 Contains the 3' end of the FUBP3 gene for far upstream element (FUSE) binding protein 3, an ribosomal protein L19 (RPL19) pseudogene, the PRDM12 gene for PR domain containing 12, the gene for RRP4 (homolog of yeast RRP4 (ribosomal RNA processing 4) 3'-5' exoribonuclease), the 5' end of two variants of the ABL1 gene for v-abl Abelson murine leukemia viral oncogene homolog 1, a ribosomal protein L37 (RPL37) pseudogene and three CpG islands, complete sequence Length=173463 Score = 350 bits (189), Expect = 3e-93 Identities = 189/189 (100%), Gaps = 0/189 (0%) Strand=Plus/Minus Query 1 CCGCGGCAGGCCGACGGCCCCACGGAGGGACATTGAAGGGGAAGTGGAGGAGAAGAGCAG 60 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
syg.edu.ee/~peil/ut_alused/arvdiagrammid.html 05.02.19. Boon, G., D. (1993) An Overview of Hemostasis. Toxicologic Pathology, nr 21, lk 170. Blom, J,W., Doggen, S.J., Osanto, S., Rosendaal, F.R. (2005) Malignancies, prothrombotic mutations, and the risk of venous thrombosis. Journal of the American Medical Association, nr 293 lk 715. Dahlbäck, B. (2000) Blood coagulation. Lancet nr 355, lk 1627. Falanga, A., Alessio, M., G., Donati, M., B., Barbui, T. (1988) A new procoagulant in acute leukemia. Blood nr 71 lk 870-875. Ferguson, J., J., Chronos, N., Harrington, R., A. (2000) The Physiology of Normal Platelet Function. Antiplatelet Therapy in Clinical Practice. London: Martin Dunitz, lk 22. Gurbel, P., A., Tantry. U., S., (2010) Combination Antithrombotic Therapies. Circulation, nr 121, lk 569. Heit, J., A. (2015) Epidemiology of venous thrombembolism. Nature Reviews Cardiology, 12. august, nr 8, lk 464 474. 29 Heit, J., A
Leukeemiaviirused promovad rakukasvu kaudsemalt kui eelmised. Nad toodavad transkriptsiooniregulaatorit tax, mis aktiveerib LTRi promootoreid ja spetsiifilisi rakugeene (nt mõned tsütokiinid). Enhancer ja promootor võivad kasvu stimuleerivate proteiinide ekspresseerumist mõjutada. Kontrollimatu rakukasv võib olla piisav, transformeerimaks raku neoplastiliseks või tekitamaks geneetilisi kõrvalekaldeid. HTLV–1 (human T–leukemia virus) põhjustab täiskasvanu ägedat T–lümfotsüütset leukeemiat (ATLL) ja HTLV–1– seotud müelopaatiat (mitteonkogeenne neuroloogiline haigus). Inimese onkoviirused on HTLV–1, –2, –5, aga ainult –1 on kindlasti haigusega seotud. Epidemioloogia. Ülekanne HIVi teid pidi. Endeemiline Lõuna–Jaapani, Kariibi mere piirkonnas, Kesk–Aafrikas, Kagu–USA mustade seas. Jaapani endeemilistes piirkondades saavad lapsed HTLV emalt rinnapiimaga, täiskasvanud aga sugulisel teel
Translokatsioon (8 - 14/8 - 22) viib c - myc onkogeeni immunoglobuliinide raske ahela geenide lähedale ja selle ekspressioon tõuseb. Normaalses rakus toodetakse c - myc veidi rakutsükli algatamiseks aga IgH läheduses ekspesseerub see vastavalt IgH tootmisele. Üheks põhjuseks on Epstein - Barr virus . Viiruse tõttu hakatakse LMP1 tootma ja edasi läheb c - myc üleproduktsioon. 15. Krooniline lümfoidne leukeemia CML (chronic Myeloid Leukemia), Translokatsioon ja liitgeeni ning liitvalgu (uudisvalgu) teke. Cleevec kui spetsiifiline liitvalgu bcr - abl aktiivsuse inhibitor . Onkogeenide seos kasvajate tekkega. Näited onkogeenidest kasvajates. Translokatsioon 9nda ja 22se kromosoomi vahel. Tekib liitgeen BCR - ABL, ning rakk hakkab tootma samanimelist liitvalku. Hübriidse valgu produktsiooni ei saa kontrollida. Gleevec on edukas ravim, mis on sünteetiline inhibitor . Onkogeenid kutsuvad esile kasvajaid
annaabi.ee 
