Geeth 1) Mis tähendab: (4p) LOA (length overall) – laeva üldpikkus Draft – süvis Lpp (Length perpendicular) – laeva pikkus loodsirgete vahel Trim – laeva trim Deadweight – laeva kandevõime TPC – laeva süvise muutus kauba tonnides ühe sentimeetri kohta Cubic capacity – laeva kaubaruumide maht kuupmeetrites (puistelasti ja vedellasti puhul) 2) Nimetage kaubalaevade tüübid (2.5p) Segalasti laevad, RO-RO laevad, konteinerlaevad, tankerid, balkerid 3) Laeva kiirust mõõdetakse mis ühikutes? Mida see lahtiseletatuna tähendab? (0.5p) Mõõdetakse sõlmedes. 1 sõlm = 1 meremiil tunnis ehk siis 1,852 km/h. Meremiil on põhiühik kauguste mõõtmiseks merel. 4) Nimetage sadamate haldussüsteemid? (1.5p) Landlord Port, Tool Port, Service Port 5) Miks veetakse kaupu mer...
Elementide arv määratakse mälu
reserveerimise käigus (see operatsioon on Javas massiivi kirjeldusest lahutatud).
Javas kasutatakse massiivi elemendile viitamiseks indeksit, mis kirjutatakse
massiivi nime järele kantsulgudesse. Massiivi element on näide L-väärtusest, s.t.
massiivi elemendile saab omistada väärtust.
Massiivi elementide arvu Javas (massiivi pikkust) väljendab Javas avaldis
"massiivi_nimi .length" (massiiv on objekt, mille avalik read-only
isendimuutuja nimega length sisaldab massiivi pikkust).
Näide.
int [] m; // massiivi
kirjeldamine
m = new int [10]; // mälu
reserveerimine massiivile
System.out.println (m.length); // massiivi
pikkuse väljastamine
m[0] = 3; // omistamine
elemendile indeksiga 0
m[1] = -8;
// massiivi väljastamine for-tsükli abil
for (int i=0; i
Upper limit - the 16% rule (Default) 2. When the tolerance limit is specified, use the table shown on the left Measure on the most critical surface. If not more than 16% of all value for condition. based on sampling length are exceed the limit, surface is acceptable. 3. When the tolerance limit is not specified. - The first value does not exceed 70% of the limit. 3.1 Estimate roughness and measure it in corresponding condition in - The first three values do not exceed the limit.
LONDON London is the capital of England and the United Kingdom, the largest metropolitan area in the United Kingdom. London's population is about 7,518,000. Click to edit Master text styles Second level Third level Fourth level Fifth level Sightseeing Madame Tussaud Wax Figures museum Westminster Abby Big Ben Buckingham Palace London Zoo Harrod's department store London Tower Bridge London Tower Bridge Tower Bridge is a combined bascule and suspension bridge in London, England, over the River Thames. It is close to the Tower of London, which gives it its name. It has become an iconic symbol of London. Harrod's department store Harrods is a high-end department store in...
otsustab, kas tegemist on tavalise, eritellimusel tehtud või reeglitele
mittevastava numbrimärgiga.
Tavalisel numbrimärgil on kaks või kolm numbrikohta, millele järgnevad
kolm tähte. Näiteks "367ARZ", "82ZBG". Tellitud ja muud erinumbrid on
kuni 9-märgilised, millest vähemalt üks on number, teised on tähed.
Näiteks "MEDIA7", "R2", "MARIKA13".
Esitamise tähtaeg - 3. märts 2014
*/
char regn[100];
int length = 0, i, j=0;
printf("Sisesta registreerimism4rgi number > ");
scanf("%s", regn);
length = strlen(regn);
//printf("%dnn", length);
// 1 Reeglitele vastavus
// 1.1 Reg. nr. pikkus
if ( length < 2 || length > 9 ){
printf("nReg. number %s ei vasta reeglitele!n", regn);
return 0;
}
// 1.2 Sisaldab vähemalt 1 numbrit
for(i=0, j=0;i
393 Gapped Lambda K H 0.267 0.0410 0.140 Matrix: BLOSUM62 Gap Penalties: Existence: 11, Extension: 1 Number of Sequences: 2250671 Number of Hits to DB: 127332226 Number of extensions: 4937094 Number of successful extensions: 13884 Number of sequences better than 10: 117 Number of HSP's better than 10 without gapping: 0 Number of HSP's gapped: 13724 Number of HSP's successfully gapped: 117 Length of query: 699 Length of database: 811773583 Length adjustment: 134 Effective length of query: 565 Effective length of database: 811773583 Effective search space: 458652074395 Effective search space used: 288253772985 T: 11 A: 40 X1: 16 (7.4 bits) X2: 38 (14.6 bits) X3: 64 (24.7 bits) S1: 41 (20.4 bits) S2: 79 (35.0 bits) b. Uurida leitud oletatavaid konserveerunud domeene, millistes vahemikes asetsevad? Mis piirkond on märgitud umbes 500 aminohappe juures? Millised on tõenäoliselt uuritavad valgud ja miks? VASTUS:
1. Töö eesmärk Analüüsida infosüsteemi häirekindlust: Joonis 1. Töös kasutatud infosüsteemi struktuurskeem Minu lähteandmed ülesandeks: Edastuskanal Modulatsioon Häirekindel kood Häirekindel kood sisene väline AWGN 2-FSK BCH (15,7) RS GF (16) 5-kordse veaparandusega Tabel 1. Lähteandmed 2. Struktuurskeemi osade lühikirjeldused 2.1 Modelleerimise struktuurskeem SIMULINKis Kogu ülesande lahendamisel kasutasin ühte ja sama struktuurskeemi: Joonis 2. Struktuurskeem SIMULINKis 2.2 Edastuskanal -> AWGN AWGN (Additive White Gaussian Noise) aditiivse valge Gaussi müraga kanal on laialdaselt kasutatav kanali mudel: Joonis 3. AWGN kanali struktuurskeem ...
Animals in Estonian forest Fox Muutke teksti laade Teine tase Kolmas tase Neljas tase Viies tase Muutke teksti laade Information Teine tase Kolmas tase Neljas tase Length: body 50 cm -80 cm. Tail 30 cm- Viies tase 50 cm. Weight: 5 kg-10 kg. Adobe: swamps, undrewoods and cultural Landscapes. Food: birds, insects, small rodents, berries. Puppies: 4-7 Life: 3-10 years. (captivity 25 years) Looks: He has a very fluff coat. This gives the impressioon he would weighs as more Badger Muutke teksti laade Teine tase Kolmas tase Neljas tase Viies tase...
Costs of use are low The least energy demanding mode of transport over long distances Large quantities Challenges of pipeline The infrastructure investment is high Not flexible for changes in the transport chain The vast majority of pipeline accidents in the United States are caused by third-party damage. Damage by outside - natural disasters Other e.g. someone excavates too close to the pipeline Three longest natural gas pipelines in the world 1. West-East Pipeline Length: 5,410 miles Start: Xinjiang, China Finish: Shanghai 2. National Unification Gas Pipeline (Gasun) Length: 3,100 miles Start: Bolivia 3. Yamal-Europe Pipeline Finish: Brazil Length: 2,608 miles Start: Siberia Finish: Germany Nord Stream Pipeline Length: 759 miles Start: Russia Finish: Germany Thank you for your attention!
R-Studio Kontrolltöö Mitu proovitükki on kogu andmestikus? #Mitu proovitükki on kogu andmestikus puud2015=read.csv("puud2015.csv",sep=";",dec=",") #Impordin andmed puud2015$D=ifelse(puud2015$D2>0,(puud2015$D1+puud2015$D2)/2,puud2015$D1) #Lisan tulba D length(table(puud2015$PRT)) #Vaatan mitu proovitükki on kogu andmestikus loetledes read > #Mitu proovitükki on kogu andmestikus > puud2015=read.csv("puud2015.csv",sep=";",dec=",") #Impordin andmed > puud2015$D=ifelse(puud2015$D2>0,(puud2015$D1+puud2015$D2)/2,puud2015$D1) #Lisan tulba D > length(table(puud2015$PRT)) #Vaatan mitu proovitükki on kogu andmestikus loetledes read [1] 229 VASTUS: Kogu andmestikus on 229 proovitükki. Mitu puud on sinu proovitükil? #Mitu puud on sinu proovitükil? PRT332=subset(puud2015,PRT=="332") #Teen eraldi andmestiku PRT332-st length(table(PRT332$PUU)) #Loetlen puude arvu PRT-l > #Mitu puud on sinu proovitükil? > PRT332=subset(puud2015,PRT=="332") #...
genome. We propose a method for rational analysis of heterogeneity of multicopy genes by compiling a profile based on quantification of different sequence variants of the internal transcribed spacers of the freshwater sponge Ephydatia fluviatilis as an example. In addition to using conventional substitution analysis, we have developed a mathematical method, the proportion model method, to quantify the relative amounts of allelic variants of different length using data from direct sequencing of the heterogeneous amplicon. This method is based on determining the expected signal intensity values (corresponding to peak heights from the sequencing electropherogram) by sequencing clones from the same or highly similar amplicon and comparing hypothesized combinations against the values obtained by direct sequencing of the heterogeneous amplicon. This method allowed to differentiate between all specimens analysed.
adjacent chars that are the same have been reduced to a single char. stringClean("yyzzza") → "yza" if(str.length()<2) return str; if(str.charAt(1)==str.charAt(0)) return stringClean(str.substring(1)); return str.charAt(0) + stringClean(str.substring(1)); 14. Given a string and a non-empty substring sub, compute recursively the largest substring which starts and ends with sub and return its length. strDist("catcowcat", "cat") → 9 return func(str, sub).length(); } private String func(String str, String sub) { int strlen = str.length(); int sublen = sub.length(); if (str.equals("")) return str; if (str.startsWith(sub)) { if (str.substring(strlen-sublen, strlen).equals(sub)) return str; else return func(str.substring(0, strlen-1), sub);} else
Polar bears · weight: adult female 175-300kg · averange life span: 25 years · lenght: 1.9-2.6m · shoulder height: 0.8-1m · fur: white to yellow · https://youtu.be/1zRGzlWqce4 · North American brown bear · aggressive · population: 20,000 · weight: adult male 270kg Grizzly bears · weight: adult female 130-200kg · length: 1.5-2.8m · shoulder height: 0.9-1.5m · fur: brown · https://youtu.be/MTcbqzYIqpk · population: 900,000 · weight: 80-300kg · length: 1.2-1.9m American black · shoulder height: 0.6-1m bear · fur: black https://youtu.be/_EPCZSww2gw https://youtu.be/oYbDQIn7XRc · spirit bear · population: under 1300
# Program: needle # Rundate: Wed Mar 07 18:02:24 2007 # Align_format: srspair # Report_file: /ebi/extserv/old-work/needle-20070307-18022349260605.output ######################################## #======================================= # # Aligned_sequences: 2 # 1: EMBOSS_001 # 2: EMBOSS_001 # Matrix: EDNAFULL # Gap_penalty: 10.0 # Extend_penalty: 0.5 # # Length: 909 # Identity: 405/909 (44.6%) # Similarity: 405/909 (44.6%) # Gaps: 504/909 (55.4%) # Score: 2025.0 # # #======================================= EMBOSS_001 1 atgttgatgattaaaggaattatttttgatatggacggtgttttatttga 50 EMBOSS_001 1 0 EMBOSS_001 51 tacagaacctttttatctgaggcgacgagaagatttttttaagacaaagg 100 EMBOSS_001 1 0
pdf Question 1 (10 marks) When converting an analogue value to a frequency, consider the following diagram describing the system. The frequency changes from 20 MHz to 18 MHz and the system samples at an interval of 2ms. How many counts does the microprocessor detect at, a) 20 MHz? b) 18 MHz? What is the difference in terms of number of counts detected by the microprocessor? Solution: 1 1 a) Converse 20 MHz to time length: T 0.00005ms f 20,000,000 2ms Number of counts in 2ms: N 40,000 0.00005ms 1 1 b) Converse 18 MHz to time length: T 0.000055556ms f 20,000,000 2ms
densities: mean solar power density on earth (over a year) is about 250 . m2 kW Regarding waves this solar energy can be transferred up to 100 inside a wave mcrl per meter of crest length. 3 Characteristics of waves Due to the depth of the sea, the heaviness of the wind and the time that wind can act the water surface, waves have different characteristics. Characteristics of waves Waves produced by a strong wind Waves caused by a strong wind over a deep sea and for a long time 4
AK-47 Place and date Russia, 1944-1946 Weight 4.3 kg (9.5 lb) with empty magazine Length 870 mm (34.3 in) fixed wooden stock Overall Barrel length Cartridge 415 mm (16.3 in) 7.62x39mm M43 Action Gas- information operated, rotating bolt Rate of fire 600 rounds/min Muzzle velocity 715 m/s (2,346 ft/s) Effective range 100800 sight adjustments m Feed system 30-round detachable
tourists residing in the hotel. This may imply that the most business people staying in the hotel are men. The women occupancy seems to peak at three points: April, October and December. The latter is probably due to couples and families (influx of people aged under 20 is in December and October too) going on vacation for Christmas, New Year's Eve and other seasonal holidays. The length of the stay is the shortest in December, which may serve as further proof for the above theory of families coming in for the winter holidays. The average length of stay also tends to drop significantly as tourists gain in occupancy percentage, which may indicate that the location of the hotel is not very favourable to tourism business as the area can probably be explored quickly. The conventions seem to affect the average length of stay positively
Physical Description The head is broad and rounded when viewed from above, but slim in profile. The body is quite round, narrowing to a slender peduncle. The top of the head and lower jaw have rounded, bump-like knobs, each containing at least one stiff hair. The body is black on the dorsal side, and mottled black and white on the ventral side. About 2/3 of the way back on the body is an irregularly shaped dorsal fin. Its flippers are very long, between 1/4 and 1/3 the length of its body, and have large knobs on the leading edge. The flukes, which can be 5.5 m wide, is serrated and pointed at the tips. Adult males measure 12.2-14.6 m, adult females measure 13.7-15.2 m. They weigh 25 to 40 tons. Feeding Feed on krill, small shrimp-like crustaceans, and various kinds of small fish. Each whale eats up to 1 and 1/2 tons of food a day. Mating and breeding Humpback whales reach sexual maturity at 6-
Finally, it leaves us with other loads corrosion, fire and loads during construction. First of all, thermal loads are sometimes called hidden or locked-in loads and caused by daily or seasonal change in air temperature. To clarify its effect, let´s assume that a steel bridge 100 m long was erected in winter at an average temperature of 2oC. On a summer day, when the air temperature reaches 32oC, the bridge lengthens, since all bodies expand when heated. The increase in length of the bridge can be computed to be only 3 cm. It is indeed small, one three thousandths of the bridge´s length, however, if the bridge is anchored to abutments that do not allow this thermal expansion, the abutments will push on the bridge to reduce its length by 3 cm. And unfortunately steel is so stiff that the compressive load uses up half the strength of the steel therefore, the bridge´s resistance weakens. And for engineers, there is only one way of avoiding this
venomous. Snakes can be found in all types of habitats. While some climb trees, others live underground, and still others are found in the waters of lakes and even seas. Facts about snakes Click to edit Master text styles As for the size, while the Second level Third level anaconda can grow up to 38 Fourth level feet in length, the brahminy Fifth level blind snake is just 2 inches long, making it the smallest snake. Like all reptiles, snakes are cold-blooded. Snakes have more than 200
oData transparency: In bit and byte oriented protocols, there is a problem if a control character (for ETX (End of Text) ·Same as ETB, only no more blocks will follow. ITB (End of > Differences with HDLC length of protocol field (1B or 2B) byte-oriented protocols) or the start-of-frame flag (for bit-oriented protocols) appears in the actual data. Intermediate Transmission Block) ·Same as ETB, except that the receiving statio Differs from HDLC because of multiaccess MAC that provides · Maximum payload length (default: 1500) This was not likely to happen in ASCII text, but is very likely with binary data
konfiguratsioon on sel juhul moonutatud. See vähendab nii mõrra vastupidavust lainetusele kui ka püügivõimet. Aeg-ajalt vajavad mõrrad veest väljavõtmist ja puahstamist. Mõrra kinnitusskeem This net is most efficient when fished in still lake waters. Setting the net is easy using four anchor points. It is the tension and float lead lines that hold the net in place. Similar to the Pennsylvania without frames. Treated - ready to fish. Body: Overall length 22'. Crib: 4' x 4' x 4' - Optionable zipper top. Wings: Usually 12' long. Leader: 50' x 4' or as required. Hood: Extends in front of trap. Netting: Usually 1/2", 3/4", or 1" square mesh. Throats: First heart turn around, leads into a second heart that goes in a crib third heart. New Hampshire Fyke Net Maine Fyke Net This design features Five 3/4" O.D.
Until 1917, when the Quebec Bridge was completed, it was the longest cantilever bridge in the world. The Forth Bridge remains the second longest. First steel structure The bridge was built in steel alone, the first bridge in Britain to use that material. It was the first major structure in Britain to be constructed of steel; Its contemporary, the Eiffel Tower was built of wrought iron. Construction The bridge is, even today, regarded as an engineering marvel. It is 2.5 km (1.5 miles) in length, and the double track is elevated 46 m (approx. 150 ft) above high tide. It consists of two main spans of 521.3 m (1,710 ft), two side spans of 207.3 m, and 15 approach spans of 51.2 m (168 ft). Each main span comprises two 207.3 m (680 ft) cantilever arms supporting a central 106.7 m (350 ft) span truss. The three great four-tower cantilever structures are 100.6 m (330 ft) tall, each 70 ft (21 m) diameter foot resting on a separate foundation
Present Perfect how long the action has been have/has + been + working. working. working? how long Progressive happening Infinitive + -ing since I have been going. I haven't been going. Have I been going? emphasis: length of time of an for action He has been He hasn't been Has he been going. going. going? englisch-hilfen.de LEARNING ENGLISH ONLINE englisch-hilfen
Amazon River LOCATION · Peru · Brazil · Ecuador · Colombia · Bolivia · Venezuela TRIBUTARIES Left: Right: · Marañón · Purus · Japurá · Madeira · Rio Negro · Tapajós · Xingu · Tocantins LENGTH & WIDTH · 6400 km · 20 km ANIMALS · Anaconda · Boto · Piranha · Bull Shark · Arapaima Thank you for listening!
Kodutöö: Lineaarne regressioonanalüüs PD <- read.csv("puud15.CSV") # parameeter sep="," ja dec="." PD$d_k<-with(PD, ifelse(d2>0,(d1+d2)/2, d1)) PD.<-subset(PD, prt==642 & aasta==2001) PD.<-droplevels(PD.) plot(h~d_k,data=PD.) PD.H <- subset(PD., h>0 & hv>0) table(PD.H$pl) PD.KU<-subset(PD.H, pl=="KU") par(mar=c(4.5,4.5,1,1)) plot(NULL,xlim=c(0,40),ylim=c(0,25),xlab="diameeter, cm", ylab="kõrgus, m") abline(v=seq(0,40,10),lty=3,col="grey75") abline(h=seq(0,25,5),lty=3,col="grey75") # abijooned points(h~d_k,data=subset(PD.KU),lwd=1) with(subset(PD., pl=="KU"),rug(d_k)) 1. Sirge h=a+b*d M1 <- lm(h~d_k, data=PD.KU) summary(M1) D<-0:40 M1.pred <- predict(M1,newdata=data.frame(d_k=D)) lines(D,M1.pred, col="red") coefficients(M1)[1] coefficients(M1)[2] # dobavit' p-value v tablicu v vide * summary(M1)$adj.r.squared summary(M1)$sigma # sqrt(sum(M1$residuals^2)/(length(M1$residuals)-2)) AIC(M1...
Ferret Compilator: MariaEva Maasik Introduction Domesticated mammal Sexually dimorphic prederators Males substantially larger Typically brown,black,white or mixed fur Avarage length 20 inches Weigh 1.54 pounds Lifespan 710 years Hunting rabbits, pets Behavior Crepuscular (1418, dawn and dusk) Social groups Marking territory Scared> emanate a smell Weasel war dance (not agressive,clucking noise) Upset> hissing noise Diet Obligate carnivores Small prey Uses of ferrets Pets Experimental animal model
The Giant Eland The Giant Eland (Taurotragus derbianus also known as the Lord Derby Eland) is an open forest savannah antelope. It is found in Central African Republic, Sudan, Cameroon and Senegal. There are two subspecies: the endangered T. d. derbianus, found in Senegal's Niokolo-Koba National Park, and the low risk T. d. gigas, found in Central Africa. Characteristics Giant Eland are typically between 220-290 cm (7.3-9.6 ft) in length, stand approximately 150 to 175 cm (4.9 to 5.7 ft) at the shoulder, and weigh 440-900 kg (968- 1,980 lb). Despite its common name, it is of very similar size to the Common Eland. The smooth coat is reddish- brown to chestnut, usually darker in males than females, with several well-defined vertical white stripes on the torso. A crest of short black hair extends down the neck to the middle of the back, and is especially prominent on the shoulders. The slender legs are
Mitmene regressioonanalüüs ja mittelineaarne regressioonanalüüs PD <- read.csv("puud15.CSV") PD$d_k<-with(PD, ifelse(d2>0,(d1+d2)/2, d1)) PD.1<-subset(PD, prt==642 & aasta==2001 & h>0 & hv>0) PD.2<-subset(PD, prt==642 & aasta==2006, select=c(puu,rin,d_k,h,hv)) names(PD.2)<-c("puu","rin_2","d_k2","h_2","hv_2") PD.1.2<-merge(PD.1,PD.2,all.x=T) with(PD.1.2, table(rin,rin_2)) PD.1.2$rin12<-with(PD.1.2, paste(rin,rin_2,sep="")) table(PD.1.2$rin12) PD.1.2E<-subset(PD.1.2, rin12 %in% c("11","22")) # rinnaspindala juurdekasv PD.1.2E$ig5<-with(PD.1.2E, (d_k2^2 - d_k^2)*pi/4) hist(PD.1.2E$ig5) # M0: ig5 = a M0<-lm(ig5~1,PD.1.2E) summary(M0) # mean(PD.1.2E$ig5); sd(PD.1.2E$ig5) # R2: 1-(sd(PD.1.2E$ig5)/var(PD.1.2E$ig5))^2 # Md: ig5 = a + b*d Md<-lm(ig5~d_k,PD.1.2E) summary(Md) # Mh: ig5 = a + b*h Mh<-lm(ig5~h,PD.1.2E) summary(Mh) # Mhv: ig5 = a + b*hv Mhv<-lm(ig5~hv,PD.1.2E) summary(Mhv) ...
Endangered spieces Cheetah General description: · member of the cat family · speeds between 112 and 120 km/h · body length is 150 cm · weight ~70 kg · mostly in africa · The largest population of cheetahs is in Namibia History Problems : · hunted by farmers · The cheetah needs large expanses of land to survive, but with changes in land use this area is becoming smaller and smaller. Now: · The wild population has fallen to half its numbers since the 1970's. · Now less than 5000-12000 are left.
A trip of mine Canary Islands Dec. 2015- Feb. 2016 Keilika Meos · Country: Spain - Gran Canaria and Tenerife Islands · Length of the trip: 1.5 months · Mount Teide · Maspalomas dunes · Amadores beach Loro park (animal park) · In Tenerife · The largest parrots population (350 different species) · Orca ocean show(has attracted critisism) and parrots making tricks Siam park (water park) · In Tenerife · One of the largest water parks in Europe · Many water activities like waterslides, wavepool, lazy river & more
Dear Elijah, I’m writing to tell you about the Estonian flag and what are the symbols of Estonia. The national symbols of the Republic of Estonia are the Estonian flag, coat of arms, anthem, but also the national bird and flower. They all have great meaning for Estonia, although nowadays it often tends to forget. The Estonian national flag is a rectangular piece of cloth, which consists of three equal width horizontal bands of colour: the upper band is blue, medium black and white underside. The correlation of the width and length is less imporatnt, but fixed as 7:11.
beauty beautify beautiful beautifully !! breadth (laius)broaden (avardama) broad (lai) broadly (laialt) care care careful carefully chat chat chatty chattily widen !! width (kestvus, wide widely laius) deepen (süvenema) !! depth (sügavus) deep deeply lengthen !! length (pikkus) long - (pikendama) PREFIXES (eesliited) Verb Noun Adjective Adverb mis- un- un- - dis- dis- in- im- re- anti- in- mis- post- ir- pre- il- dis-
Top 10 Most Endangered Species 1. Black Rhino 6. Alligator Snapping Turtle 2. Giant Panda 7. Hawksbill Turtle 3. Tiger 8. Big Leaf Mahogany 4. Beluga Sturgeon 9. Green-Cheeked Parrot 5. Goldenseal 10. Mako Shark Black rhino The Black Rhinoceros or Hooklipped Rhinoceros. An adult Black Rhinoceros stands 140170 cm high at the shoulder and is 3.33.6 m in length. An adult weighs from 800 to 1,400 kg . The females are smaller than the males. Black rhino Alligator Snapping Turtle largest freshwater turtles in the world about 12 years of age. Female clutch of 1050 eggs hunted for their carapaces Alligator Snapping Turtle Thank you!!!
Red Panda nimi Description Average length is 56 to 63 cm Tail is about 40 cm long Can weigh up to 6,2 kg They have long and soft fur Long claws for climbing narrow tree branches Behavior They are territorial Mostly quiet They Sleep during the day become more active in the afternoon They clean like a cat does Diet Mostly eating Bamboo May eat other small mammals , birds , eggs, blossoms and berries. They need to consume a large volume of bamboo to survive Habitat Click to edit Master text styles Second level Third level Fourth level Fifth level References http://translate.google.ee/?hl=et&tab=wT http:// www.google.ee/url?sa=t&rct=j&q=red%20panda&source=web&cd=1&ved=0CCsQFjAA&ur
TENNIS Katriin Mering 11B ABOUT Between two players (singles) Between two teams of two players each (doubles) Racket Send the ball through the opponent's racket side Ball diameter is 6.35cm to 6.67cm and weighs 57-59 grams Court length is 23.77m and a width is 8.23m for singlegame and 10.97m for doublegame. Racket can't be longer than 81.28cm or greater than 31.75cm. Adult racket weighs 300-325 grams. 15, 30, 40 and the fourth point bring victory The player (or couple) who wins six games, wins set HISTORY Originated in France in the 12th century Patented by major Walter Clopton Wingfield Program of the Olympic tennis was the from 1896 to 1924 thank you for listening! Mainor Business School
Can you tell by a single sound I make, whether I am straight, bi or gay? As ridiculous as it might sound and casting aside all stereotypes, it actually seems possible. Unbelievable? Well, sociolinguistics, sociopathology, sociophonetics are all very fascinating subjects. Never thought a single word or a sound you make could tell random strangers who you are? Well, prepare to be convinced otherwise. (Well, not solely by these two articles or my short conclusions, of course, it is a very wide field and there is yet much research to be done.) Anyhow, here I have found two research articles, both dealing with whether it is possible to distinguish someone's sexual identity solely based upon a few words, or much less, a single phone. As it turns out, it is. How it is done, is also shown (although I must admit that my current education did not allow me to understand all the details of the methods used) and a lot of research poured into findi...
Brooklyn Bridge · Carries: motor vehicles (cars only), elevated trains (until 1944), streetcars (until 1950), pedestrians and bicycles · Crosses: East River · Designer: John Augustus Roebling · Opened: May 24, 1883 · Total length: 1825 m · Architectural style: Gothic · Connects Manhattan and Brooklyn · Longest suspension bridge in the world until 1903 · The first steelwire suspension bridge · On the first day, 1800 vehicles and 150 300 people crossed Brooklyn Bridge · Emily Warren Roebling was the first to cross the bridge · The towers are built of limestone, granite and Rosendale cement Notable events · First jumper: Robert E. Odlum on May 19, 1885
South American coati Coati`s are very cute animals they have reddish-brown fur and ringed tails, they have black and grey markings on their face. The ears are small and rounded. They weight 3.5–6 kg and total length is about 1 m, half of that beingit´s tail. They usually live in the forest and typically sleep in the trees. They are omnivorous. Females generally live in large groups, consisting of 15 to 30 animals. Males are usually alone. After a gestation period of 77 days, Coatis give birth to 3 - 4 young. The narrow, elongated head ends in a very flexible snout which it pokes under rocks and into crevices in search for food. South American Coatis are also known as: Southern Ring-Tailed Coati
Rhino Made by: Gert Metsküla 7.a Introduction 5 extant (alles jäänud) species Two in Africa and three in southern Asia large size herbivorous diet thick protective skin relatively small brains (400600g) large horn acute hearing and sense of smell, but poor eyesight Most live to be about 60 years old or more. White Rhinoceros Exceed 3500 kg head-and-body length of 3.5-4.6 m height of 180-200 cm White Rhinoceros was about 4600 kg White Rhinos is about 14,500 Black Rhinoceros Live in south-Africa Black Rhinoceros stands 150 175 cm weighs from 850 to 1600 exceptionally to 1820 kg Two horns are made of keratin what is 50 cm long exceptionally up to 140 cm Indian Rhinoceros in Nepal and North- Eastern India. weighing from 2500 3200 kg silver-brown skin is from 3-4 meters long. What we can to do to save rhinos life?
Beam trawls are used to harvest whitefish, mainly flatfish such as sole, plaice or megrim together with angler and other species found hard down on the seabed. Each net is fished from an outrigger boom, one on each side of the vessel (Figure 14), and towed from here on a single warp (a) shackled to a three chain bridle (b) attached directly to the beam (c) which holds open the mouth of the trawl. The beam, 9-12 m in length, is constructed from heavy steel tube and supported on each side by rugged steel trawlheads (d) which slide over the sea bottom. Ahead of each groundrope several tons of tickler chains (e) or chain mats (f) are used to disturb fish, causing them to rise up and be taken by the trawl following immediately behind. Towing speeds are generally higher than otter trawling, reaching 6 or 7 knots on clean ground with ticklers, whereas on rough ground stone mats are towed at around 4 knots
of Great Britain to prevent military raids by the tribes of Scotland to the north, to improve economic stability and provide peaceful conditions in the Roman province of Britannia to the south, to physically mark the frontier of the Empire, and to separate the unruly Selgovae tribe in the north from the Brigantes in the south and discourage them from uniting. The name is also sometimes used jocularly as a synonym for the border between Scotland and England, although for most of its length the wall follows a line well south of the modern border -- and neither the Scoti tribe nor the English lived in Britain at the time of the wall's construction. The wall was the northern border of the Empire in Britain for much of the Roman Empire's rule, and also the most heavily fortified border in the Empire. In addition to its use as a military fortification, it is thought that the gates through the wall would also have served as customs posts to allow trade taxation.
Estates • Construction of the bridge began in 1998 • opening on 10 June 2000. Closing, unexpected & not safety? • Londoners nicknamed Wobbly Bridge • crossed by 90,000 people, with up to 2,000 on the bridge at any one time. • a charity walk on behalf of Save the Children • Swaying motion • Closed after two days of limited access. • Reopened after two years when the bridge was entirely safe. In 2002. Particulars : • Design : Suspension bridge • Total length: 370 meters • Width: 4 meters • Longest span:144 meters • 5,000 people on the bridge at one time • on 28 April 1999 by Monberg Thorsen and Sir Robert McAlpine • cost of £18.2 million A little bit more.. • closed on 18 January 2007, during the Kyrill storm( strong winds and safety) About films : • featured in the film adaption of Harry Potter and the Half-Blood Prince, • at the beginning of the first episode of Ashes to Ashes. Images :
The Yellow River BY ANNABEL AND EGLE About… Country Main cities China Hohhot Basin population Jinan 189 millions Zhengzhou Size Yinchuan 945,065 km2 Lanzhou Length… 5464 km The 2nd longest river in China (after the Yangtze River.) The 3rd longest river in Asia. The 7th longest in the world. Tributaries Wei River Luo river Fen River Jin River Source and mouth… Source Mouth Name - Bayan Har Mountains Location - Yushu Prefecture, Qinghai Name - Bohai Sea Location - Kenli County, Shandong Tourism Zhongshan Bridge Hukou waterfall Wild life The Yellow River has only single near-endemic fish speaces. The Chinese Paddlafish 30% of the fish in the Yellow River are extinct. Red pandas Pandas Snake-neck...
Nr. of Nr. of …………… Time, s Cover, % Cost Time, s Cover, % Cost vectors vectors Deterministic Genetic Random Cost = Cv + Ct + C%, where α, β, and γ are to be chosen by the following rules: Cv = α · (Nr. of vectors) – cost of test length, - 10 additional test vectors can be justified by 1% of Ct = β · (Time,s) – cost of test generation time, fault coverage gain; - we agree to spend 10 seconds more to generate C% = γ · (100% - Cover,%) – cost of fault coverage 1-vector shorter test.
Question 1 Name 9 characteristic parameters of sensors. Solution: 1. Thershold. 2. Sensitivity. 3. Full Range. 4. Linearity. 5. Accuracy. 6. Precision. 7. Stability. 8. Hysteresis. 9. Noise. Question 2 Given the circuit below (using a SYH-2R humidity sensor) determine the output voltage for a relative humidity of 70 % at 30 °C if RT = 50 kΩ and VDD= 2.5 V. Solution: Check specification for Humidity Sensor of SYH-2R.pdf at: http://www.rhopointcomponents.com/images/SYH-2R.pdf 2 Week 04 Homework - Solutions Check Thermistor - Wikipedia.pdf at http://en.wikipedia.org/wiki/Thermistor Calculate the Humidity Sensor resistance at 30°C T = 273.15°C +30°C = 303.15°C T0 = 273.15°C +25°C = 298.15°C R60% 30°C =25.5858 kΩ - Matlab code: 33*exp(4600*(1/303.15-1/298.15)) = 25.5858 Calculate the Humidity Sensor resistance at relative humidity 70% See the above graphic for the standard resistance:...
Robert Kasela 10A 2009/2010 The bridge takes its name from its location, not its design. Designed by Sir Horace Jones and engineered by Sir John Wolfe-Barry. Employed 432 construction workers. The total cost of construction was £1,184,000. Sir H.Jones Sir Total length 244 meters (801 ft) Hight 63 meters Opened 30 June 1894 Clearance below 8.6 meters (28 ft) 70,000 tons of concrete were sunk into the riverbed to support the construction. Over 11,000 tons of steel provided the framework for the towers and walkways. Tower Bridge is also simply one of the most unique venues in London for weddings, private and corporate events. The lifting of Tower Bridge has become a must see event for visitors to London.
Koalas The koala is an arboreal herbivore marsupial native to Australia. It is easily decide by its strong, tailless body; round, fluffy ears; and large, spoon-shaped nose. The koala has a body length of 6085 cm and weighs 415 kg. Fur colour ranges from silver grey to chocolate brown. At the beginning of the 20th century people hunted Koala because their fur. Today this animal is under the protection but they still are in danger. Koalas from the northern populations are typically smaller and lighter in colour than the other. Most of their food consists of eucalypt leaves but sometimes they eat other leaves too. There is about 600 species of eucalypt, koalas eat only 30. Because
fishing. A study shoes that, rather than pollution, fishing appears to be the biggest threat to porpoises. Each year more than 10000 porpoises are killed in the seas around Britain. Fishingboats are using a technique witch consists in leaving the nets on the sea bed for several hours. When porpoises come to feed on the sea bed, they get caught in the nets and drown. There is a need for a research to make nets safer for porpoises. For example, one possibility would be to restrict the length of nets. This should be a duty of marine mammal organisations. Also should be limited the allowed amount of fish to be caught. This should be the duty of The Ministry of Agriculture, Fisheries and Food. Naturally it is not possible to forbid fishing but some restrictions can surely be done. It is very important to maintain the balance in our seas. Every creature has its importance and we should protect them. Yours faithfully, Triin Engmann
annaabi.ee 
Sisene Facebook'ga
Sisene Google'ga
Sisene LinkedIn'ga
