Vajad kellegagi rääkida?
Küsi julgelt abi LasteAbi
Logi sisse
Sulge

"bits" - 81 õppematerjali

bits - > uses transmission controlcharacters before each block • known as SYN (synchronous idle) transmission of a frame andretransmission of the frame will not correct the insertion.
Järjestuste võrdlemine-otsingud andmebaasidest-BLAST-FASTA-SW-
23
doc

Järjestuste võrdlemine, otsingud andmebaasidest (BLAST, FASTA, SW).

Number of extensions: 4937094 Number of successful extensions: 13884 Number of sequences better than 10: 117 Number of HSP's better than 10 without gapping: 0 Number of HSP's gapped: 13724 Number of HSP's successfully gapped: 117 Length of query: 699 Length of database: 811773583 Length adjustment: 134 Effective length of query: 565 Effective length of database: 811773583 Effective search space: 458652074395 Effective search space used: 288253772985 T: 11 A: 40 X1: 16 (7.4 bits) X2: 38 (14.6 bits) X3: 64 (24.7 bits) S1: 41 (20.4 bits) S2: 79 (35.0 bits) b. Uurida leitud oletatavaid konserveerunud domeene, millistes vahemikes asetsevad? Mis piirkond on märgitud umbes 500 aminohappe juures? Millised on tõenäoliselt uuritavad valgud ja miks? VASTUS: Konserveerunud domeenid 500 aminohape juures on valgu piirkond mis, ei sarnane mitte ühtegi valguga.

Informaatika → Bioinformaatika
41 allalaadimist
Subnettid
1
txt

Subnettid

Problem 1 Host IP Address 172.30.1.33 Network Mask 255.255.0.0 Network Address 172.30.0.0 Network Broadcast Address 172.30.255.255 Total Number of Host Bits 16 Number of Host 65534 Problem 2 Host IP Address 172.30.1.33 Network Mask 255.255.255.0 Network Address 172.30.1.0 Network Broadcast Address 172.30.1.255 Total Number of Host Bits 8 Number of Host 254 Problem 3 Host IP Address 192.168.10.234 Network Mask 255.255.255.0 Network Address 192.168.10.0 Network Broadcast Address 192.168.10.255 Total Number of Host Bits 8 Number of Host 254 Problem 4 Host IP Address 172.17.99.71 Network Mask 255.255.0.0 Network Address 172.17.0.0 Network Broadcast Address 172.17.255.255 Total Number of Host Bits 16 Number of Host 65534 Problem 5 Host IP Address 192.168.3.219 Network Mask 255.255.0.0 Network Address 192.168.0.0

Informaatika → Informaatika
7 allalaadimist
Mictrocontroller Week 03
14
pdf

Mictrocontroller Week 03

0100 0101 01102 === 2. Extend the following unsigned 8-bit binary numbers to their 16-bit equivalents and convert the result to hexadecimal. a) 011010112 b) 101101012 === 2. a) 006B b) 00B5 === 3. Extend the following signed two’s complement 8-bit binary numbers to their 16-bit equivalents and convert the result to hexadecimal. a) 011010112 b) 101101012 === 3. a) 006B b) FFB5 === Logic and arithmetic 4. Using two’s complement arithmetic, calculate the following (choose a suitable number of bits for the representation): a) 121 – 185 b) -70 – 88 == 4. Convert back to verify answer == 5. Calculate the following without converting the number base. Show calculations. a) 3A916 + 24D16 == 5. 5F616 == 6. Variable X contains the number of bytes to be read from an external device. Using a binary shift, write one line of pseudocode to calculate the number of bits to be read and store the result in Y. == 6

Mehhatroonika → Mehhatroonika
5 allalaadimist
Mikrokontrollerid ja robootika homework 1
14
pdf

Mikrokontrollerid ja robootika homework 1

Result in hexadecimal = 00B516 = B516 3. Extend the following signed two’s complement 8-bit binary numbers to their 16-bit equivalents and convert the result to hexadecimal. a) 011010112 16-bit equivalent is 0000 0000 0110 10112 Result in hexadecimal = 006B16 b) 101101012 16-bit equivalent is 1111 1111 1011 01012 Result in hexadecimal = FFB516 Logic and arithmetic 4. Using two’s complement arithmetic, calculate the following (choose a suitable number of bits for the representation): a) 121 – 185 = -64 121 in 16-bit binary is 0000 0000 0111 1001 -185 in 16-bit binary is 1111 1111 1011 1001 -64 in 16-bit binary is 1111 1111 1100 0000 00000000 01111001 + 11111111 10111001 --------------------------- 11111111 11000000 b) -70 – 88 = -158 11111111 10111010 - 00000000 01011000 ------------------------- 11111111 01100010 5. Calculate the following without converting the number base

Mehhatroonika → Mikrokontrollerid ja robootika
6 allalaadimist
Homework 2 Week 4
12
docx

Homework 2 Week 4

Week 4 homework. Question 1: 1. SNR – Ratio of root mean square signal to root mean square. 2. SINAD – Ratio of the RMS signal amplitude to the mean of value of the root sum square. 3. ENOB – The effective number of bits and relates to SINAD. 4. THD – Ratio of the rms value of the fundamental signal to the mean value of RSS of its harmonics. 5. SFDR – Ratio of the RMS value of the signal to the RMS value of the worst spurious signal. 6. Channels – multiple analog signal inputs to the ADC that can be individually selected or selected through a multiplexor. 7. Linearity – Describes how an ADC conveter follows a linear function. 8

Keeled → Inglise keel
4 allalaadimist
Homework 2 Solution
12
pdf

Homework 2 Solution

mean-square (rms ) signal to rms noise. 2. SINAD stands for Signal-to-noise and distortion ratio. It is a measure of the quality of a signal from a communications device, often defined as: where is the average power of the signal, noise and distortion components. SINAD is usually expressed in dB. For examples to calculate the ratio of 1 kW (one kilowatt, or 1000 watts) to 1 W in decibels, use the formula 3. ENOB is the effective number-of-bits related to SINAD and the quality of a digitized signal. The 6.02 term in the divisor converts decibels (a log10) to bits (a log2) The 1.76 term comes from quantization error in an ideal ADC 4. THD - Total harmonic distortion is the ratio of the root-mean-square (rms) value of the fundamental signal to the mean value of the root-sum-square

Mehhatroonika → Mehhatroonika
3 allalaadimist
Tööstuslik andmeside kontrolltöö 2 abimaterjal - vastused
3
doc

Tööstuslik andmeside kontrolltöö 2 abimaterjal - vastused

start of frame ­ send DLE STX 2. prior to transmission insert DLE for any inadvertent DLE 3. transmit is signaled ·received stream searched on bit basis for SOF & EOF · frame divided layers provide byte oriented service) to reliably support the connection). end of file ­ send DLE ETX Receive side: 1. receive DLE STX -> indicates start of frame sequence 2. into fields that are often multiples of 8 bits 1. scheme: flags (often used on point- ­ Sequence numbers grow from 3b to 7b link termination Using LCP, PPP can terminate the link at anytime. inspect each byte in the payload until EOF sequence. If byte(i) = DLE: ­ if byte(i+1) = DLE -> indicates point links) ­ flag = 01111110, unique byte pattern for SOF & EOF ­ frame read on · Control field for unnumbered frames (lacking sequence This might happen because of:

Informaatika → Tööstuslik andmeside
31 allalaadimist
CPM1A Programmable Controllers Operation Manual 1784470
402
pdf

CPM1A Programmable Controllers Operation Manual 1784470

Application Precautions 5 • Do not touch the cold junction compensator. Doing so may result in incor- rect temperature measurement. ! Caution Always clear memory before beginning to program the CPM1A. Although memory is cleared before the CPU Unit is shipped (except for bits with specific functions), AR 1314, which turns ON when the internal capacitor cannot back up memory, may have turned ON during shipment. ! Caution If the CPM1A will be turned off for periods exceeding the data backup period of the internal capacitor, design the system so that it will not be influenced if data in

Tehnika → Automatiseerimistehnika
9 allalaadimist
Microcontroller homework 2
2
docx

Microcontroller homework 2

Microcontroller homework for week 04 1. SNR - Ratio of RMS signal to RMS SINAD - Ratio of the RMS signal amplitude to the mean value of the root-sum-square (RSS) ENOB - The effective number-of-bits and relates to SINAD THD - Ratio of the rms value of the fundamental signal to the mean value of the RSS of its harmonics. SFDR - Ratio of the RMS value of the signal to the RMS value of the worst spurious signal. Channels related to the inputs of the ADC can either be multiplexed or individually selected. Linearity relates to how a ADC follows a linear function. All ADCs are to a certain extend non-linearity.

Masinaehitus → Mikrokontrollerid ja...
46 allalaadimist
Mikrokontrollerid ja robootika homework 2
14
pdf

Mikrokontrollerid ja robootika homework 2

Question 1 Define the following ADC terms: 1. SNR – (Signal to Noise Ratio) SNR is a calculated value that represents the ratio of RMS signal to RMS noise. 2. SINAD - (signal-to-noise-and-distortion ratio) Ratio of the RMS signal amplitude to the mean value of the root-sum-square (RSS) 3. ENOB – (effective number of bits) The effective number-of-bits and relates to SINAD 4. THD - (total harmonic distortion) Ratio of the rms value of the fundamental signal to the mean value of the RSS of its harmonics. 5. SFDR - (spurious free dynamic range) Ratio of the RMS value of the signal to the RMS value of the worst spurious signal. 6. Channels - related to the inputs of the ADC can either be multiplexed or individually selected. 7. Linearity - relates to how a ADC follows a linear function

Mehhatroonika → Mikrokontrollerid ja robootika
10 allalaadimist
What is performance
2
docx

What is performance?

What is performance?  Any and all of the activities of human life can be studies “as” performance  Investigate what the object does, his interaction with other objects and beings, how it relates to other objects or beings  Performances exist only as actions, interactions and relationships  Restored behaviour or the “twice behaved behaviours”  Key process of performance  All behaviour consist of bits of previously behaved behaviour  Marked, framed, heightened  Something “is” a performance when historical and social context, convention, usage and tradition says it is  Make-believe performances maintain a clearly marked boundary between the world of the performance and everyday reality (children playing, actors on stage)  Make-belief performances intentionally blur or sabotage that boundary (everyday life, public figures)

Keeled → Inglise keel
1 allalaadimist
10 klassi unit 1 sõnad
1
docx

10 klassi unit 1 sõnad

Hero ­ kangelane History ­ ajalugu Improve ­ tõestama Interview ­ intervjuu Logo ­ logo Politician ­ poliitik Prison ­ vangla Rent ­ rent Spell ­ hääldama Staff ­ meeskond Wealth ­ varandus Wedding ­ pulmad On cloud nine ­ seitsmendas taevas In high spirits ­heas tujus A whale of a time ­ väga tore Look on the bright side ­ positiivselt suhtuma Laughing our heads off ­ naerust kõveras Make someone's day ­ õnnelikuks tegema Out of this world ­ jumalik Thrilled to bits ­ vasikavaimustuses Over the moon ­ üliõnnelik Work wonders ­ imet tegema Fingers crossed - Pöialt hoidma There's light at the end of the tunnel - Tunneli lõpus valgust nägema

Keeled → Inglise keel
66 allalaadimist
Digital Signal Processing Vocabulary
3
docx

Digital Signal Processing Vocabulary

unwanted sound, is used to cancel the unwanted sound artificial reverberation generated by electrical or tehislik reverberation acoustical means to simulate that of järelkõla natural rooms, added to a signal to make it sound more lifelike bit a single binary value, the smallest unit bitt of data in a computer byte a unit of data that is eight binary digits bait (bits) long CAD computer-aided design, the use of raalprojekteeri computer systems to aid in the creation, mine modification, analysis, or optimization of a design computed a diagnostic imaging test used to create kompuuter- tomography detailed images of internal organs, tomograafia bones, soft tissue and blood vessels DAC digital-to-analog converter, a system digitaal-

Informaatika → Digisignaalide töötlemine
5 allalaadimist
Poolitamine
12
doc

Poolitamine

vur-rud, kan-nan, põl-lul, tup-pa 3) Kaashäälikuühendis viiakse järgmisele reale viimane häälik. vors-tid, krõmp-sub, kat-ki, varg-si 4) Ühetäheline silp sõna ees jääb rea lõppu. meie-ga, leia-me, jõua-te, laua-le 5) Ühte tähte ei jäeta rea lõppu ega viida järgmisele reale. õde, ema, meie, nõu, kaua, tuua 6) Täishäälikuühendit ei poolitata. kau-gel, mei-le, tõu-seb, tuu-led 7) Sõnaalguse kahetähelist silpi pole tavaks jätta rea lõppu. ÄRA NII POOLITA! aa-bits, ee-sel, uu-dis, oo-tan, ii-ris 8)Liitsõnu poolitatakse sõnade liitekohalt. puu-labidas, tee-rist, tule-tõrje MINA ­ MA SINA ­ SA TEMA ­ TA MEIE ­ ME TEIE ­ TE NEMAD ­ NAD Sõnades ma, sa, ta, me, te, nad kirjutatakse täishäälik ühe tähega. Sõnades mul, sul, tal, kirjutatakse l ühe tähega. Lause algab suure algustähega. See on minu kodulinn. Lapsed õpivad koolis. Kõik nimed ja kohanimed kirjutatakse suure algustähega. Minu kodulinn on Valga. Mina, Tiina ja Mati

Eesti keel → Eesti keel
30 allalaadimist
At the time when Columbus discovered America
1
docx

At the time when Columbus discovered America

are of German ,Irish and English descent. About 30 millions African Americans live in the USA.They are the descendants of Africans brought to America as slaves in the 17th century. For them the USA is a kind of melting pot , where they have become Americans. Others have kept their traditions and culture , so for them their new homeland is like a salad bowl. But perhaps it is better to say that the population of the United States is like a pizza , where we can see different bits and pieces , but together they make something much bigger.

Keeled → Inglise keel
1 allalaadimist
Mis on alamvõrgu mask
1
txt

Mis on alamvõrgu mask?

Give one example: You have sales and customer service department, you want sales and customer services dep. computers are not connected same network. Now you need use Subnet mask on aadress, mis defineerib ra vrgu suuruse, mitu subneti on vrgus ja kui palju on ip aadresseid hostide jaoks. The subnet mask is an address that defines the size of the network, how many subnets you can use and how many ip addresses are for hosts. ell, like an IP address, a subnet mask also consists of 32 bits. Computers use it to determine the network part and the host part of an address. The 1s in the subnet mask represent a network part, the 0s a host part.

Informaatika → Informaatika
3 allalaadimist
Homework 01
2
docx

Homework 01

base-5 is d)BCD is 2. a) Unsigned 16-bit binary is 0000000001101011. Hexadecimal is 6B b) Unsigned 16-bit binary is 0000000010110101. Hexadecimal is B5 3. a) Signed two's complement 16-bit binary is 0000000001101011. Hexadecimal is 6B. b) Signed two's complement 16-bit binary is 1111111110110101. Hexadecimal is FFB5 4. a) 1111001 +1111111101000111 1111111111000000 b) 10111010 + 10101000 1111111101100010 16-bits is suitable. 1 5. += (9+D=16; A+4+1= F; 3+2=5) 6. Y=X shl 3 7. (A and B) or ((not A) and (not B)) 8. Y = true for i from 1 to 20 for j from 1 to 8, excluding 3 bitindex = j + (i-1)*8 if S1[bitindex] S2[bitindex] Y = false Exit loop end end end 9. A) V and C (the operation produced an overflow and the operation produced a carry)

Masinaehitus → Mikrokontrollerid ja...
52 allalaadimist
E-book – the book of the future
2
doc

E-book – the book of the future

About the aesthetic point of view. In our family there was a tradition that children got a beautifully wrapped paper book for their birthday present. E-books can never provide the physical feel of the cover, paper, and binding of the original printed work. The shelf life of a printed book exceeds that of an e-book reader. Over time the reader's battery will drain and require recharging. Additionally, there is no guarantee that [electronic] copies will last. Bits become degraded over time. Documents may get lost in cyberspace... Due to faults in hardware or software, e-book readers may malfunction and data loss can occur. As with any piece of technology, the reader must be protected from the elements (such as extreme cold, heat, water, etc.). Because of the high-tech appeal of the e-reader, e-books are a greater target for theft than an individual print book. Along with the theft of the physical device, any e-books it contains also become stolen

Keeled → Inglise keel
7 allalaadimist
Andmeturbe
8
pdf

Andmeturbe

• Hour glass model e OSI mudeli 7 levelit • Encapsulation ja decapsulation – sõnumi liikumine läbi kihtide • ISP – internet service protocol • IPV4 • Et saadetud info jõuaks õigesse kohta, peavad ruuterid omavahel suhtlema (IP aadressi vaja teada) • Rooting protocol – ntks IS-IS • Prefix – Ip aadress, mis on 32 biti on kaheks jagatud – host ja network. • Network part (prefix) high order bits – kirjeldab füüsilist võrku; Host part – ütleb, milline host selles võrgus • TCP source and destination 16- bit TCP port number (IP addresses from IP layer) • 4,5 billion addressses • IPV 6 • Tegelikult IPV4 uuem versioon • Suuremad aadressid – 128 biti • Ipv4 aadressid ammu otsas, töötab, sest kõik aadressid ei ole samal ajal ühenduses. • 2. kiht on sama, 4

Informaatika → Andmeturbe alused
23 allalaadimist
18
pdf

automatically as we would have to enter the password every time the service restarts.  -days 365: This specifies that the certificate we are creating will be valid for one year.  -newkey rsa:2048: This option will create the certificate request and a new private key at the same time. This is necessary since we didn't create a private key in advance. The rsa:2048 tells OpenSSL to generate an RSA key that is 2048 bits long.  -keyout: This parameter names the output file for the private key file that is being created.  -out: This option names the output file for the certificate that we are generating. Sudo nano /etc/apache2/sites-available/default-ssl.conf Sudo a2ensite default-ssl.conf Sudo service apache2 restart Failipuu krüpteerimine o Paigaldage pakett ecryptfs-utils Sudo apt install ecryptfs-utils o looge kasutaja lotte kodukataloogi alamkataloog salajane

Varia → Kategoriseerimata
16 allalaadimist
Arvutiõpetuse põhimõisted
6
docx

Arvutiõpetuse põhimõisted

materjalihulgast endale vajalike teksti üles leida. Portaal- On rohkeid ressursse ja teenuseid(e- post,uudisegrupp,otsimootorid,elektronkauplused,päevauudised jt) ehk kasutaja kõiki infovajadusi ühes kohas rahuldada püüdev veebisait. Andmeside-Nimetatakse andmete kogumist väljastamist sidekanalite kaudu,mis hõlmab nende edastamist ja vastuvõtmist nii analoog- kui ka digitaalkujul.Andmeedastuse kiiruse ühikud: bps (bits per second9- bitte sekundis(bit/s) standartne mõõtühik andmesidevõrkudes. Bood-edastuskiiruse ühik elektrisignaali muutuste arv sekundis.Andmesides on võimalik kodeerida ühe signaalimuutusega enam kui 1 bitti, nii , et bood ja bit/s pole samatähenduslikud mõistes.Näiteks 9600 bit/s kiirusega modem töötab tavaliselt boodisagedusega 2400 boodi. Arvutid igapäevaelus Arvutid kodus Õppimine ja hobid- väga efektiivne õppimisvahend lastele ja täisealistele.

Informaatika → Arvutiõpetus
25 allalaadimist
Võrgutarkvara ja selle eripärad
29
ppt

Võrgutarkvara ja selle eripärad

Abiks, kui võrk on suures majas või mitme maja vahel. · Võrgumängud (DOOM, Heretic ...). NB! Suur võrgukoormus, segab võrgu normaalset tööd !!! Sidevahend- modem · Modem - modulaator/demodulaator on seade telefoniliini ja arvuti vahel, et arvutid saaks suhelda telefoniliini vahendusel. · On nii sisemisi, kui ka välimisi. Välimised tavaliselt kallimad ja hõlpsamini teisaldatavad. Mitmesuguste kiirustega: laialt levinumad 1200 bps (bits per second - bitti sekundis) kuni 28800 bps, olemas veel ka 33600 bps, absoluutne maksimum on umbes 46800 bps Internet · Ühendumine püsiühenduse (TCP/IP) või modemiga (UUCP, SLIP, PPP); · Püsiühenduse puhul tarvis installeerida/konfigureerida protokollivirn, mille parameetrid saab teenusepakkuja käest (ntx. võrgudoomen, nimeserver (DNS server), väravmasin (gateway), masina IP aadress ja nimi, alamvõrgu mask (Subnet Mask) ).

Informaatika → Arvutivõrgud
25 allalaadimist
Essey-How does the United States influence Estonia
6
odt

Essey: How does the United States influence Estonia

German language. During the first half of 20th century, Estonian language was closer to Finnish and the second half of 20th century was dominated by Russian influences. In the 21th century, however, Estonian language has been stoutly impacted by English. Some people are very protective and resolute about preserving Estonian language with its linguistic diversity just as it is without any foreign influences. Some say that it is only natural that every language changes, picking up bits and pieces of other languages. I believe both "parties" are correct, but I also believe that we must be careful, unless instead a normal development of our language we get overrun by another language, thereby mutating Estonian into Estonglish. Everything even remotely tourist/abroad aimed is labelled firstly in English and in very small letters in Estonian. I do believe in broadcasting ourselves. I believe in translations. But I believe that going about in, say, Tallinn, and reading the

Keeled → Inglise keel
6 allalaadimist
Molekulaarbioloogia protokoll
16
docx

Molekulaarbioloogia protokoll

Contains the 3' end of the FUBP3 gene for far upstream element (FUSE) binding protein 3, an ribosomal protein L19 (RPL19) pseudogene, the PRDM12 gene for PR domain containing 12, the gene for RRP4 (homolog of yeast RRP4 (ribosomal RNA processing 4) 3'-5' exoribonuclease), the 5' end of two variants of the ABL1 gene for v-abl Abelson murine leukemia viral oncogene homolog 1, a ribosomal protein L37 (RPL37) pseudogene and three CpG islands, complete sequence Length=173463 Score = 350 bits (189), Expect = 3e-93 Identities = 189/189 (100%), Gaps = 0/189 (0%) Strand=Plus/Minus Query 1 CCGCGGCAGGCCGACGGCCCCACGGAGGGACATTGAAGGGGAAGTGGAGGAGAAGAGCAG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 55971 CCGCGGCAGGCCGACGGCCCCACGGAGGGACATTGAAGGGGAAGTGGAGGAGAAGAGCAG 55912 Query 61 GGGCGACCCGGAGGGGTGGCTGGGCCGGGGCGGGCAAGACAGTCTCAGGGCCCGGCAGCC 120

Bioloogia → Molekulaar- ja rakubioloogia...
103 allalaadimist
Book Analog Interfacing to Embedded Microprocessors
568
pdf

Book Analog Interfacing to Embedded Microprocessors

2, “Digital-to-Analog Converters”). Dynamic range is usually expressed in db because it is usually a measurement of relative power or voltage. However, this does not cover all the things that a microprocessor-based system might want to measure. In simplest terms, the dynamic range can be thought of as the largest value that must be measured compared to (or divided by) the small- est. In most cases, the essential number that needs to be known is the number of bits of precision required to measure or control something. As an example, say that we want to measure temperatures between 0°C and 100°C. If we want to measure with 1°C accuracy, we would need 100 discrete values to accomplish this. An 8-bit analog-to-digital converter (ADC) can divide an input voltage into 256 discrete values, so this system would only need 8 bits of precision. On the other hand, what if we want to measure the

Mehhatroonika → Mehhatroonika
11 allalaadimist
Emaplaadi terminite sõnastik inglise keeles
5
docx

Emaplaadi terminite sõnastik inglise keeles

whereas a DIMM has 64-bit path. Because the Pentium processor requires a 64-bit path to memory, you need to install SIMMs two at a time. With DIMMs, you can install memory one DIMM at a time. SIMM - Acronym for single in-line memory module, a small circuit board that can hold a group of memory chips. Typically, SIMMs hold up 8 (on Macintoshes) or 9 (on PCs) RAM chips. On PCs, the ninth chip is often used for parity error checking. Unlike memory chips, SIMMs are measured in bytes rather than bits. SIMMs are easier to install than individual memory chips. The bus from a SIMM to the actual memory chips is 32 bits wide. A newer technology, called dual in-line memory module (DIMM), provides a 64-bit bus. For modern Pentium microprocessors that have a 64-bit bus, you must use either DIMMs or pairs of SIMMs. Chipset Models - Today there are many chipset models in the marketplace. The most popular for mainstream desktop computers are Intel's 810, BX, LX, and ZX. There are also "third

Tehnoloogia → Arvutitund
1 allalaadimist
Old English Literature
3
doc

Old English Literature

invasion and the second Roman "invasion" of Great Britain, who were the leaders, what influence did they leave on the culture of Great Britain? Celtic Britain was during the Bronze Age, there were many small tribal kingdoms fighting one another. Many megalithic monuments were built around that time, e.g. Stonehenge, the Avebury ring. The Roman Invasion ­ 55-54 BC, Julius Caesar ruled Rome, Rome built the Hadrian's wall (73 miles long, built in 121 ­ 127 AD) against the Picts and Scots, bits have survived till today. The Romans bring along the Christian faith ­ The beginning of Christianization of the Celts. The Romans withdrew their forces together with the fall of the Roman empire. Anglo Saxon Invasion ­ 5th ­ 6th century AD. Germanic tribes from Scandinavia: the Angles, the Saxons and the Jutes settle in what today is known as England and force the Celtic tribes to move to Scotland, Ireland, Wales.

Kirjandus → Inglise kirjandus
30 allalaadimist
Harry Potter Worksheet
7
doc

Harry Potter Worksheet

Can you find and then correct them? Harry Potter The Harry Potter books are the best books I ever read. They are quite long, but I have read all them and my mum says she will buy me the next one when it come out. My favourite is first one, Harry Potter and the Philosopher's Stone. I think the autor must have a great image to be able to create all those caracters. I also like the Harry Potter films, and have got two of them in DVD. My favourite bits in the films are when Harry and the other students on Hogwarts plays the game of Quidditch, which looks like great fun. Part V: Would you like to study in Hogwarts? Why? (Write around 90 words) 1/9/2013 Page |5 __________________________________________________________________________

Keeled → Inglise keel
14 allalaadimist
9 klassi eesti keel
9
docx

9.klassi eesti keel

VÕRDED ALG KESK ÜLI ilus ilusam kõige ilusam ehk ilusaim sõbralik sõbralikum kõige sõbralikum ehk sõbralikem õhukeseim VS õhem- ÕIGE on õhem lühikesem VS lühem- ÕIGE on lühem 12.POOLITAMINE pea, saia ke, üle uju tus, iga le, riiu lil, min nak se, pronks, korst naid, aa bits (viimaste võib poolitada, sest ühte tähte Ei VÕI üksi jätta, aga kahte VÕIB) 13.SILBITAMINE sa jab, a ru kas, hüü e, mai as, va he aeg, see ri a, e ma, kan nat lik ku de le, au sõ na 14.MÄÄRSÕNAD 6 vahel- mõnikord/ millegi vahel vahest- ehk, võib-olla vast- äsja, just enamus- konkreetselt piiritletud, üleloetav enamik- lihtsalt suurem osa millestki õieti- tõtt-öelda

Eesti keel → Eesti keel
44 allalaadimist
Kommunikatsioonimudel
102
pdf

Kommunikatsioonimudel

Hosts can use other network-layer protocols besides IP. IP and other data-link layer protocols (e.g., Novell IPX or AppleTalk) each have there own, standardized type number. Furthermore, the ARP protocol has its own type number. Cyclic Redundancy Check (CRC) (4 bytes): The purpose of the CRC field is to allow the receiving adapter to detect whether any errors have been introduced into the frame, i.e., if bits in the frame have been toggled. Preamble: (8 bytes) The Ethernet frame begins with an eight-byte preamble field. Each of the first seven bytes of the preamble is 10101010; the last byte is 10101011. The first seven bytes of the preamble serve to "wake up" the receiving adapters and to synchronize their clocks to that of the sender's clock. The last two bits of the eighth byte of the preamble (the first two consecutive 1s) alert adapter B that the "important stuff" is about to come.

Tehnoloogia → Tehnoloogia
18 allalaadimist
Arvutipordid
10
doc

Arvutipordid

nimest - mis võimaldab arvutil neid omavahel mitte segamini ajada. Andmeedastus toimub seadmete vahel 1 biti kaupa. Enamike arvutite serial pordid toetavad kas RS-232C või RS-422 standardit. RS-232 standardi puhul on tegu asünkroonse andmeedastusega. See tähendab seda, et andmeid saadetakse ainult siis, kui vastuvõttev seade selleks valmis on. Serial pordi andmeedastuskiirus on piiratud, ulatudes 115 200 bp/s (bits per second). Juhtme pikkus ei tohiks ületada 20 m, vastasel juhul hakkab andmeedastuskiirus vähenema. COM1 COM2 Seadmed ühendatakse kas DB-9 (väiksem) või DB-25 (suurem) pistikusse. DOS toetab nelja serial porti COM1, COM2, COM3 ja COM4. Serial portidele on eraldatud vaid 2 IRQ-d. Seega ei saa korraga töötada seadmed, mis on ühendatud portidesse 1 ja 3. Port Base IRQ

Informaatika → Arvutivõrgud
55 allalaadimist
Interneti otsimootorite kasutamisvõimalused
14
doc

Interneti otsimootorite kasutamisvõimalused

11.0: Sustainability, Participation, Action (Gothenburg, Sweden ... LSE, London: EU Kids Online ... Cite Save More Being Publicly Private: Extreme Nationalist User Practices on Social Networks A Siibak - Security in Cyberspace: Targeting Nations, …, 2014 - books.google.com ... secure the existence of our people and a future for white children', http://archive. ... Herzog, S.(2011),'Revisiting the Estonian cyber attacks: digital threats and multinational responses', Journal ... meet bits: social media, the mobile web and augmented revolution', Future Internet, 4: ... Cite Save Nimi:ANNERIIN TRUU Õpperühm:IK 12 9. Leidke eestikeelseid materjale, mille pealkirjas esineb märksõna „infosüsteem“. Palju ja mida leiate? Leian 6 materjali. [CITATION] Infosüsteem ESTER uueneb Ü Treikelder - 2001 - Raamatukogu Cited by 2 Related articles Cite Save [CITATION] Takseermudelite ja andmestike infosüsteem puistu kasvukäigu modelleerimiseks A Sims - 2009

Informaatika → Infootsing: allikad ja...
34 allalaadimist
Inglise keele ajalugu-essee-My languages
6
odt

Inglise keele ajalugu, essee "My languages"

Came back with very little knowledge of Greek language, though. (Although we did learn to read most of the signs). So when my course mates wanted me to impress the Greek teacher, I was not so very sure if the teacher would have been so very impressed being called a "mallaca". Which means "shit-head" and is used innumerously in all occasions. And there is also "ella!" which does not mean anything but you can make it mean everything. I've managed to pick up some bits and pieces of other languages as well – bit of Spanish, some words of Italian, a tiny bit of Finnish, some German (blaming Rammstein and my Neuss friends for that!) and even some made-up languages. Ten or eight years ago I spoke a quite fluent Quenya – that is high-elvish made up by Tolkien. I've created a few languages as well, for either writing or roleplay purposes. Lastly, I'd like to return to English. Like I said before, once I got into reading books in English, I never stopped

Filoloogia → Inglise keele ajalugu
4 allalaadimist
Elektroonika Alused
46
doc

Elektroonika Alused

BCD-koodi kasutavad nt. numbertabloode dekoodrid. NRZ-kood Non-return to zero encoding is commonly used in slow speed communications interfaces for both synchronous and asynchronous transmission. Using NRZ, a logic 1 bit is sent as a high value and a logic 0 bit is sent as a low value (the line driver chip used to connect the cable may subsequently invert these signals). A problem arises when using NRZ to encode a synchronous link which may have long runs of consecutive bits with the same value. The figure below illustrates the problem that would arise if NRZ encoding were used with a DPLL recovered clock signal. In Ethernet for example, there is no control over the number of 1's or 0's which may sent consecutively. There could potentially be thousands of 1's or 0's in sequence. If the encoded data contains long 'runs' of logic 1's or 0's, this does not result in any bit transitions. The lack of transitions prevents the

Elektroonika → Elektroonika alused
154 allalaadimist
Side Eksam 2016
42
pdf

Side Eksam 2016


 TCP - Transmission Control Protocol lõhub paketid tükkideks ja paneb jälle kokku IP - Internet Protocol kommunikatsioon arvutite vahel, aadressidega tegeleb HTTP - Hyper Text Transfer Protocol viib kliendi requestid serverisse ja serverist toob veebimaterjali kliendile HTTPS - Secure HTTP sama mis HTTP, aga nt kaardimaksete puhul jms FTP - File Transfer Protocol failiedastus arvutite vahel Informatsiooni mõõtühikud: bitt ja bait, nende detsimaalliited. • 1 byte (B) = 8 bits (b) • 1 Kilobyte (K / KB) = 2^10 bytes = 1,024 bytes • 1 Megabyte (M / MB) = 2^20 bytes = 1,048,576 bytes • 1 Gigabyte (G / GB) = 2^30 bytes = 1,073,741,824 bytes • 1 Terabyte (T / TB) = 2^40 bytes = 1,099,511,627,776 bytes bit - b - 0 or 1 byte - B - 8 bits informatsiooni hulk I = loga = ( 1 / P ), kus a=2 siis kasutatakse byte ja bit, P on tõenäosus kõvaketaste ja cd-de tootjad kasutavad 10 astmeid nt KB = 1000 B

Informaatika → Side
195 allalaadimist
Lõiketöötluse projekt
50
pdf

Lõiketöötluse projekt

CNSC%C9%BE0%3A%2Bwithout%2Bcoolant%24%22&rtoolitem=dynamicstringvalues %3D%5E%22PRODFAM%C9%BECoroTurn%20107%24%22&rtoolitem=dynamicstring values%3D%5E%22CZC%C9%BE20%20x%2020%24%22#/?active=toolitem, kasutamise kuupäev: 07.01.2015 [9.] Allikas: http://ekool.tktk.ee/pluginfile.php/52473/mod_resource/content/2/Loikeprot%20 fuusikalis%20alused.pdf, kasutamise kuupäev 07.01.2015 [10.] Allikas: http://uk.rs-online.com/web/p/centre-drill-bits/0542784/, kasutamise kuupäev: 07.01.2015 [11.] Allikas: http://www.sandvik.coromant.com/en-gb/products/pages/productdetails.aspx ?c=460.1-1020-031A0-XM%20GC34&m=6241443, kasutamise kuupäev: 07.01.2015 22 [12.] Allikas: http://www.sandvik.coromant.com/en-gb/products/pages/productdetails.aspx ?c=460.1-1826-055A0-XM%20GC34&m=6241498, kasutamise kuupäev: 07.01.2015 [13

Masinaehitus → Lõiketöötlus
65 allalaadimist
C-Progammeerimise keel
16
doc

C# Progammeerimise keel

suvalist nullist erinevat väärtust. Programmi koostamisel saab määrata lihtmuutujate ja struktuurmuutujate elementide väärtuste jaoks sobivad esitusviisid ehk tüübid, käsutades spetsiaalseid deklareerimislauseid 1. string tekst1=Console.ReadLine(); int arv1=int.Parse(tekst1); 2. string s1,s2; s1 = Console.ReadLine().ToLower(); s2 = ""; Category Bits Type Range/Precision Signed 8 sbyte ­128...127 integral short 16 ­32,768...32,767 32 int ­2,147,483,648...2,147,483,647 64 long ­9,223,372,036,854,775,808...9,223,372,036,854,775,807 Unsigned 8 byte 0...255 integral ushort 16 0...65,535 32 uint 0...4,294,967,295 64 ulong 0..

Informaatika → Arvutiõpetus
60 allalaadimist
Inglise leksikoloogia kordamisküsimuste vastused
24
doc

Inglise leksikoloogia kordamisküsimuste vastused

intention or to make a sentence more precise and clean. Runs in the family VS It is common throughout the line of our extended family over a number of generation. Examples: pull smb leg, kick the bucket, Jump the gun - would mean to be doing something early 46. Syntactic freezes (irreversible binomials, trinomials) Irreversible idiom – a multi-word expression whose order cannot be hanged. Also known as freezes Binomial idiom= a two-part irreversible idiom bits and pieces, through thick and thin, spick and span, here and there, safe and sound Trinomial idiom = a three part irrereversible idiom here, there, and everywhere Semantic principles of ordering – me first principle Phonological ordering principles (myopia or the short-long 1) Proximal deictics precede distal deictics this andthat, principle) (Ross) here and there PLACE 1 PLACE 2

Filoloogia → Leksikoloogia ja...
37 allalaadimist
Side eksami jaoks küsimused
21
docx

Side eksami jaoks küsimused

Igaüks saab ülesse (915 – 890) / 3 MHz = 25/3 MHz ja alla (960 – 935) / 3 = 25/3 MHz ühendusest. Sagedused saab GSM tabelist võtta. 3. Valige sidekanali seaded ning leidke vajalik bitikiirus sidekanalist, tagamaks start/stopp meetodil järjestikliidese kaudu failiülekande, milles on 1000 sümbolit ning ülekandeaeg 1 sekund. 1 startbitt, 2 stoppbitti, paarsuskontroll even, sümbolis 7 bitti. 1+2+1 + 7 = 11 bits 1000 * 11 = 11000 b/s 4. Riigis X jaotatakse 3G FDD sagedusala 5 operaatori vahel. Milline on igale operaatorile eraldatav sagedusala, kui jaotus operaatorite vahel on ühtlane. Jagame sagedusala operaatorite arvuga ja vähendame tulemust esimese lairibasammu kordseni. Sagedusala = 60, lairibasamm 5 ja operaatoreid 5. 60 / 5 = 12 5 on siin operaatorite arv. Nüüd vaatad, et samm on 5MHz, seega 12 ei sobi. 10 on hea vastus. Ja Ja

Informaatika → Side
58 allalaadimist
Side konspekt 2020- eksami kordamisküsimused
45
docx

Side konspekt 2020 / eksami kordamisküsimused

per inch). Seotud sellesosas, et pikslid võivad olla eri suurustega. (suurem ekraan ei tähenda, et on rohkem piksleid, vaid seal võivad olla suuremad pikslid, mis viivad PPI indeksi alla(teravus häguneb)). 40. Mida tähendab kui helisignaal on salvestatud 24 bitisügavuse ja 48 kHz? Mida need parameetrid tähendavad? In digital audio using pulse-code modulation (PCM), bit depth is the number of bits of information in each sample, and it directly corresponds to the resolution of each sample. Examples of bit depth include Compact Disc Digital Audio, which uses 16 bits per sample, and DVD-Audio and Blu-ray Disc which can support up to 24 bits per sample. 48kHz viitab Sampling-ule (signal processing) - it is the reduction of a continuous- time signal to a discrete-time signal. A common example is the conversion of a

Informaatika → Side
79 allalaadimist
Leksikoloogia konspekt-uus
20
doc

Leksikoloogia konspekt (uus)

 Phraseological idioms – frozen forms  Sayings and proverbs o Don’t wash your dirty linen in public, don’t count your chicken before they’re hatched. 48. Syntactic freezes (irreversible binomials, trinomials)  Syntactic freezes aka irreversible idioms are multi-word expressions, whose order can’t be changed. o Binomial – two-part freeze  Bits and pieces, spick and span, thick and thin, safe and sound o Trinomial – three-part freeze  Here, there, and everywhere; left, right, and centre; blood, sweat, and tears; calm, cool, and collected 18  There are semantic rules for the order of words:

Keeled → Inglise keel
14 allalaadimist
Sissejuhatus infotehnoloogiasse konspekt 2020
10
docx

Sissejuhatus infotehnoloogiasse konspekt 2020

λ EksamEksam 1 Eksamiks:  pead teadma suuruse-numbreid ja mida nad tähendavad: bitt, bait, kilobait, megabait jne; Bit Eksam/ EksamBitt 1 or 0 Byte Eksam/ EksamBait 8 Bits Kilobait Eksam(KB) 1 024 Bytes Megabait Eksam(MB) 1 024 KB  kuidas Eksamtähti Eksamkodeeritakse:  ASCII (American Standard Code for Information Interchain) 8bit = 16 * 8 = 128 märki  EBCDIC (Extended Binary Coded Decimal Interchange Code) 8bit, IBM  UNICODE (Extended ASCII) (utf-8), 1Byte for first 128, up to 4B for the rest~143 859 märki

Informaatika → Sissejuhatus...
110 allalaadimist
Muusikaajalugu
15
doc

Muusikaajalugu

Pakub vaimset vaheldust. Töölaulud muudavad töö teatud astmeni lauluks. Töölaulu liigid: 1) Istanduse laulud- plantation songs 2) Ahelais töötavate vangide laulud- chain gang songs Lauldi grupis 3) Meremeeste laulud- Shantys 4) Karjaste hõiked- hollers 5) Lootside hõiked- sounding calls Soolo 6) Tänavakaupmeeste hüüded- street cries Louis Armstrong My mule is white My face is black I sell my coal Two bits a sack Teemad millest lauldi: Söögist, ohutustehnikast, hea palk, Alan Lomax- säilitas töölaulude kultuuri. Järgmised muusikastiilid mis tekkisid oli Spirituaal ja Gospel. Spirituaal on Ameerika neegrite keskel sündinud vaimulik laulumuusika, mille tekst on võetud piiblist. Muusikaliselt on saanud mõjutusi protestantide muusikast+ Euroopa ja Aafrika folkloor. Spirituaalide tekstid on tulevikku suunatud ja helged. Jumal ei ole keegi

Muusika → Muusikaajalugu
15 allalaadimist
Arvutivõrkude konspekt
14
pdf

Arvutivõrkude konspekt

võimalik vahetult edasi toimetada (s.t. kas sihtarvuti asub samas alamvõrgus, mis gatewaygi). Kui see pole võimalik, saadetakse pakett edasi järgmisesse ruuterisse (see tehakse kindlaks samamoodi gateways asuva ruuditabeli põhjal). Nii toimitakse senikaua, kui pakett on jõudnud sellesse alamvorku, kus asub sihtarvuti ja see on võimalik vahetult kohale toimetada. 27. Vigade avastamine ja parandamine EDC (error detection and correction bits) - liiasus, mida on vaja selleks, et vigu 13 parandada, Paarsuse kontroll Ühedimensioonilise paarsuse kontrolli korral on võimalik avastada paarituarvu bittide moondumist. Samas ei ole võimalik kindlaks teha, milline bittidest täpselt moondus. Kahedimensioonilise paarsuse kontrolli korral on võimalik vigu parandada, kui moondunud on üks bitt. Interneti kontrollsumma

Informaatika → Arvutiõpetus
116 allalaadimist
Austraalia kohta inglise keelne referaat
11
doc

Austraalia kohta inglise keelne referaat

Scientists estimate that the continent is home to more than one million plant and animal species. Many of these are found nowhere else on the planet. Among these animals are kangaroos, wombats, koalas. They carry their babies in pouches. There are platypuses and tiny anteaters (echidna) too, which are the only mammals in the world that lay eggs. Among the birds are emus, lyrebirds and black swans. When a platypus specimen first reached to Europe people thought it was a fake, sewn together from bits of other animals. The platypus, the strangest of Australia’s animals, is a living reminder of ancient, extinct creatures. The best known animal that lives in Australia is the kangaroo of course. There are about 50 species of kangaroo, ranging in size from the big red kangaroo of the outback to wallabies and smaller rat-kangaroos. Kangaroos are marsupials too. Their babies develop inside their mother’s pouch. About half of Australia’s 230 mammal species are marsupials

Keeled → Inglise keel
24 allalaadimist
Molekulaarbioloogia praktikumi protokoll
18
doc

Molekulaarbioloogia praktikumi protokoll

GGGGTTCCCGGCCTAGGGGAAGGGCTATGACAATGGAATGACAACCGCGG Homo sapiens chromosome 15 genomic scaffold, alternate assembly CHM1_1.0 Sequence ID: ref|NW_004078084.1|Length: 73034944Number of Matches: 1 Related Information Map Vieweraligned genomic context Range 1: 36420564 to 36420672 GenBank Graphics Score Expect Identities Gaps Strand 202 bits(109) 8e50 109/109(100%) 0/109(0%) Plus/Plus Features: 233 bp at 5' side: poly [ADPribose] polymerase 16 42144 bp at 3' side: immunoglobulin superfamily DCC subclass member 3 precursor

Bioloogia → Molekulaarbioloogia
31 allalaadimist
Home Assignments
14
doc

Home Assignments

on stress and intonation over some 45 minutes. It does not mean that every minute has to be spent on pronunciation work. Students may work on listening skills before or work on aspects of vocabulary before going on word stress, sounds, spelling. 12 · Discrete slots: some teachers insert short, separate bits of pronunciation work into lesson sequences. Such slots can be useful, and provide a welcome change of pace and activity during a lesson. · Integrated phases: many teachers get St-s to focus on pronunciation issues as an integral of a lesson. When listening something we can draw their attention to pronunciation features. · Opportunistic teaching: teachers deal with the pronunciation problem

Keeled → Inglise keel
11 allalaadimist
Arvutite eksam
100
docx

Arvutite eksam

helisignaalist hetkväärtusi (sample). Saadud hetkväärtused viiakse digitaalsele kujule ning salvestatakse arvuti mällu, kus neid hiljem vajadusel muudetakse. 4. Pooljuhtmälud Pooljuhtmälud põhinevad samal valmistamistehnoloogial, mis protsessorid. Pooljuhtmälud asendasid välja varem kasutusel olnud kallid/ebatõhusad ferriitmälud. Pooljuhtmälusid iseloomustab kõrge tihedus, mida mõõdetakse eelkõige bits per chip. Jagunevad staatilisteks, dünaamilisteks ja read-only (ROM). 1. Staatiline pooljuht suvapöördusmälu (SRAM) – Toodetakse pannes mitmeid latche silikoon chipile. Väga lühike access time, samas 4 korda kallim kui dünaamiline RAM. Mahutavuselt ka 4 korda madalam kui dünaamiline RAM. Staatilise RAMi puhul salvestatakse andmed flip-flopidega, iga flip-flop koosneb 4st transistorist. SRAMi eelis on see, et andmed on püsivad kuniks on voolupinge. DRAM puhul peab mälu aga

Informaatika → Arvutid
46 allalaadimist
Lühendite seletus
120
doc

Lühendite seletus

BOB Break-out Box BOC Basic Operator Console BOF Beginning Of File BOM Basic Online Memory [IBM] + Beginning Of Message BOND Bandwidth On Demand BOOTP Bootstrap Protocol [Internet] BOPS Billion Operations Per Second BORPQU Borland Pro Quattro BORQU Borland Quattro BOS Basic Operating System BOT Beginning Of Table + Beginning of Tape + Robot BP Base Pointer BPB BIOS Parameter Block BPDU Bridge Protocol Data Unit Berkeley Packet Filter BPI Bits Per Inch BPL Branch If Plus + Broadband Over Power Lines BPM Business Process Management [Microsoft] BPP Bits Per Pixel BPR Business Process Re-engineering [Linux] BPS Bits Per Second + Bytes Per Second BPSK Binary Phase Shift Keying BR Bad Register BRGC Binary Reflected Gray Code BRI Basic Rate Interface + Brain Response Interface BS Backspace BSAM Basic Sequential Access Method BSC Base Station Controller + Binary Synchronous Communication

Informaatika → Informaatika
117 allalaadimist
Introduction of SCM
40
doc

Introduction of SCM

You cannot disconnect the telephones and fax machines just because you have supply chain software in place. 3. Many mistakes at first:- There is a diabolical twist to the quest for supply chain software acceptance among your employees. New supply chain systems process data as they are programmed to do, but the technology cannot absorb a company's history and processes in the first few months after an implementation. Forecasters and planners need to understand that the first bits of information they get from a system might need some tweaking. If they are not warned about the system's initial naiveté (simplicity), they will think it is useless. In one case, just before a large automotive industry supplier installed a new supply chain forecasting application to predict demand for a product, an automaker put in an order for an unusually large number of units. The system responded by predicting huge demand for the product based largely on one unusual order

Varia → Kategoriseerimata
3 allalaadimist


Sellel veebilehel kasutatakse küpsiseid. Kasutamist jätkates nõustute küpsiste ja veebilehe üldtingimustega Nõustun