Statistika osa avaneb graafikust © 1996, PASCO scientific © 1998, TPU Rakendusfüüsika öppetool P16 - 3 PASCO scientific 4 P16: Impulsi jäävuse uurimine I Science Workshop paremal. Vajutage sellel nuppu Statistics Menu ( ) ja valige statistka menüüst Curve Fit, Linear Fit. 2. Esimese sensori graafikul tömba hiirega ristkülik ümber piirkonna, (vankrikese nr.1 graafik x(t)), mis näitab liikumist enne kokkupörget. Tee seda sama vankrikese nr.2 graafikul. 3. Vastavalt teooriale söltub konstantse kiirusega liikuva keha koordinaat (asend) ajast järgmise seaduse alusel: x x 0 vt , kus x on koordinaat, xO -- keha koordinaat ajahetkel t=O, v -- keha kiirus ning t -- aeg.
How genre and narrative makes meaning in ``The Black Dahlia`` When analyzing a film, people understand the movie is much more complicated than it seems. To make a difference, to give a meaning to the film, film-makers have used different visual and thematic features. There are macro features (genre, narrative) as well as micro features (mise en scene, cinematography) and they are linked together in many ways. I have chosen to analyse the closing sequence of ``The Black Dahlia``, directed by Brian de Palma, and I will focus on macro features in this essay. Brian de Palma is well known director, who is focused on noir area through his career (he was once considered as a Hitchcock imitator) ``The Black Dahlia" can be classified as Film Noir. The genre is called Film Noir due to the `serie noir` books, which were publised in France (bethween 1940s and 1950s). These books were transl...
Töö nr.8 Nõrga elektrolüüdi dissotsiatsioonikonstandi määramine Valemid: Rx=R*(AD/DB) K=l/S K=R* Andmed: R=(1/)*(l/S) R=K*(1/) 0,t=0,25*(1+*(t-25)) Kc=2*C/(1-) 0=0,+ + 0,- =0* =/C 25°C 25°C 25°C 25°C 19°C 19°C 0CH3COOH I osa 0,01 M KCl lahuse ta...
Tallinn University of Technology Department of Electrical Engineering ELECTRONICS AND SEMICONDUCTOR ENGINEERING Exercises Linear circuits Student: xxxxxxxx Code: xxxxxx Group: xxxxxx TALLINN xxxx 1.1 RL-Circuit L1 100mH Uout=4V V1 232.5 Vrms
Support span 100,000000000 mm Span ratio 2 Fixture type 4-point Included Final width 10,000000000 mm Final thickness 1,000000000 mm Final length 40,000000000 mm Final diameter 10,000000000 mm Final Inner diameter 8,000000000 mm Final outer diameter 10,000000000 mm Final wall thickness 1,000000000 mm Final area 0,100000000 cm^2 Final linear density 5,500000000 dtex Custom text input 1 Custom text input 2 Custom text input 3 Custom text input 4 Custom text input 5 Custom text input 6 Custom text input 7 Custom text input 8 Custom text input 9 Custom text input 10 Custom text input 11 Custom text input 12 Custom text input 13 Custom text input 14 Custom text input 15 Custom text input 16 Custom text input 17 Custom text input 18 Custom text input 19 Custom text input 20 Custom number input 1 0,000000000
sum square. 3. ENOB – The effective number of bits and relates to SINAD. 4. THD – Ratio of the rms value of the fundamental signal to the mean value of RSS of its harmonics. 5. SFDR – Ratio of the RMS value of the signal to the RMS value of the worst spurious signal. 6. Channels – multiple analog signal inputs to the ADC that can be individually selected or selected through a multiplexor. 7. Linearity – Describes how an ADC conveter follows a linear function. 8. Operating temperature – A temperature at which the ADC functions optimally, usually given by the manufacturer. 9. Power dissipation – The proportion of power dissipated (through heat) when the ADC is working. Question 2: An 8 bit ADC has a reference voltage of 5V. What is the digital output code word for an input of 1.2V? 001111012 What is the voltage range corresponding to 1 LSB? 0,0195V Question 3. A 15 bit ADC has a reference voltage of 10V
(J)=0,014229 (eV) Metalli ja pooljuhi temperatuurisõltuvus 130 10000 9000 125 8000 7000 Metalli takistus Ω 120 6000 Linear (Metalli takistus Ω) 115 5000 Metalli takistus Ω Pooljuhi takistus Ω Pooljuhi takistus Ω 4000 Exponential (Pooljuhi 110 3000 takistus Ω)
Ctyr = f(t) 0.12 0.1 0.08 CTyr (mg/ml) 0.06 0.04 0.02 0 0 300 600 900 t (sek) Ctyr = f(t) Linear (Ctyr = f(t)) 3 (0,09-0,056)10 (12+ 0,5)52 A= =7,83 kat / g (750-150)1810,50,01 Järeldus: Savinaasi proteolüütiline aktiivsus on 7,83 kat/g. Türosiini kontsentratsioon ja aeg on seotud lineaarse sõltuvusega, siis katsetulemused pidid graafikul langema ühele sirgele. Koostatud graafikul kõik katsepunktid peaaegu langesid ühele sirgele
ja paralleelsuse tolerantsid, et tagada liistliite koostamine. 8.9 Kasutatud kirjandus [8.1] Ülesanne 8 – Liistliidete tolerantsid ja projekteerimine. [8.2] Purde, M. Tolerantsid ja istud. Tallinn. Tallinna Tehnikakõrgkool. [8.3] Purde, M. Ülesanded iseseisvaks tööks tolereerimises ja mõõtetehnikas. [8.4] ISO 286-1:2010; Geometrical product specifications (GPS) — ISO code system for tolerances of linear sizes — Part 1: Basis of tolerances, deviations and fits. [8.5] ISO Tolerances for Shafts ISO 286-2:2010. [8.6] ISO 2491:1974; Thin parallel keys and their corresponding keyways. [8.7] Mehaanikainseneri käsiraamat. Tallinn. Tallinna Tehnikaülikool, 2012. 492 lk. [8.8] Tabel 13 - liistliite suhtelised mõõtmed.
TTÜ Mereakadeemia Üld- ja alusõppe keskus Elise Vainokivi TARBEPLASTID Kodutöö nr. 6 Juhendaja: lektor Aleksander Lill Esitatud:......................................... Kontrollitud:.................................. Punkte:........................................... Tallinn 2020 Sisukord POLÜETÜLEEN (PE) .......................................................................................................... 3 POLÜVINÜÜLKLORIID (PVC) .......................................................................................... 4 POLÜPROPÜLEEN (PP) ..................................................................................................... 5 Kasutatud kirjandus............................................................................................................... 6 ...
deq Equivalent diameter of the tank m da Diameter of the agitator m dc Diameter of the coil m din Inside diameter of the tube m hi Convective heat transfer coefficient inside the coil W·m-2·K-1 ho Convective heat transfer coefficient outside coil W·m-2·K-1 k Slope of linear function k Thermal conductivity W·m-1·K-1 m ´ Mass flow kg·s-1 ma Mass of water inside the bath kg m ´b Mass flow rate inside the coil kg·s-1 Nu Nusselt number q Heat J
X1 8,3099697405 5,8901885958 1,410816 0,164747 -3,5330479689 20,15299 Y ja X1 hajuvusdiagrmm 40000000 30000000 X1 Paarisregressioonivõrra 20000000 Linear Regression for X1 nd on: y=0,0048x+2E+06 10000000 f(x) = 0,0047913117x + 2283156,57898946 0 0 1 000 000 000 2 000 000 000 Y,X2 SUMMARY OUTPUT Regression Statistics Multiple R 0,8160228572
Hadrian expanded on this idea, redesigning the German border by ordering a continuous timber palisade supported by forts behind it. Although such defences would not have held back any concerted invasion effort, they did physically mark the edge of Roman territory and went some way to providing a degree of control over who crossed the border and where. Hadrian reduced Roman military presence in the territory of the Brigantes and concentrated on building a more solid linear fortification to the north of them. This was intended to replace the Stanegate road which is generally thought to have served as the limes (the boundary of the Roman Empire) until then.
alkoinfo.ee Thank you for listening. Do you have any questions? potent - powerful diffuse to spread over or through excessive too much on something lethargy - A state of apathy with lack of emotion or interest stupor - A state of reduced consciousness or sensibility cardiovascular - Relating to the circulatory system, that is the heart and blood vessels. malabsorption not abrorbing sustained - held continuously at a certain level correlation - linear statistical relationship between two random variables, indicating both the strength and direction of the relationship hypertension - The disease or disorder of abnormally high blood pressure adverse - unfavorable sedative-hypnotics - are drugs which depress or slow down the body's functions withdrawal - A type of metabolic shock the body undergoes when a substance, usually a toxin such as heroin, to which a patient is addicted is withheld.
TalTech keemia ja biotehnoloogia instituut YKA0060 Instrumentaalanalüüs AAS Aatomabsorptsioonspektromeetria Õpperühm: Töö teostaja(d): Õppejõud: Töö teostatud (kuupäev): 1 Töö eesmärk Määrata uuritavas veeproovis magneesiumi sisaldus kasutades kalibratsioonigraafikut ja molaarse neeldumiskoefitsienti. 2 Töö käik Tundmatu lahus: tundmatu kontsentratsiooniga Mg veelahus. Lahjendused: Töölahus: 100 mg/L (Mg; vees) Kasutame nt 100mL mõõtkolbi. Pipeteerime vajalik kogus töölahust ja viime veega kriipsuni. x mg / 0,1 L = 0,5 mg /1L x = 0,05 mg (peab pipeteerima mõõtkolbi) Kui 1000mL-s on 100 mg ainet, siis 1mL on 0,1mg ja 0,1mL on 0,01mg. Seega tuleb võtta 0,5mL töölahust. Vajalikud lahjendused: o 0,5 mg/L (0,5 mL TL-i) o 1 mg/L (1 mL TL-i) o 2 mg/L (2 mL TL-i) o 5 mg/L (5 mL TL-i) o 10 mg/L (10 mL TL-i) ...
(RSD) SD= 0,0816 RSD= 12,18 % Kalibratsioon 1.2 1 f(x) = 0.39x - 0.12 R² = 1 0.8 0.6 I paralleel Piigi kõrgus II paralleel 0.4 III paralleel 0.2 Linear (III paralleel) 0 0 0.5 1 1.5 2 2.5 3 3.5 Kontsentratsioon Kontrolllahuse kontsentratsiooni leidmine y = 0,3893x-0,1174 => x=(y+0,1174)/0,3893 1) 0,66 x=(0,66-0,1174)/0,3893=1,39 μg/ml 2) 0,67 x=(0,67-0,1174)/0,3893=1,42 μg/ml 3) 0,68 x=(0,68-0,1174)/0,3893=1,45 μg/ml Keskmine väärtus 1,42 μg/ml 4. Kokkuvõte ja järeldused
Kokkuvõte · Jätsin välja silmasuurused 32 mm , 64mm ja 72 mm , kuna neid isendeid kes sinna sattusid ei olnud piisavalt ja kõveras ei tulnud välja. · Kui soovitakse Pakri + Muuga lahes tagada ,et alamõõdulist kala ei jääks saaki üle 25% , peab minimaalne nakkevõrgu silmasuurus olema 64 mm. · Selle sain selektiivsuskõveralt , kus võtsin minimaalseks kala pikkuseks 19mm ( see on ahvena alammõõt) ning vedasin joone kuni 25 % linear jooneni ja lugesin xteljelt vastava silmasuuruse. Sain 64 millimeetrit. TÄNAN TÄHELEPANU EEST!
Tallinna Tehnikaülikool Keemiainstituut Analüütilise keemia õppetool Aatomabsoptsioonspektraalanalüüs Juhendaja: Jelena Gorbatsova Tallinn 2014 Teooria Spektroskoopia on meetod aatomite ja molekulide iseloomustamiseks nende poolt neelatud, hajutatud ja kiirgunud elektromagnetilise kiirguse põhjal. AAS- on aatomispektromeetria meetod, mis põhineb aatomite elektronide ergastumisel valguse neeldumise toimel. Analüüdi tuvastamiseks kasutatakse ära nähtust, kus gaasifaasis olevad elemendi aatomid absorbeerivad valguskiirgust (valguskvante ehk footoneid) vaid teatud lainepikkustel. Teades, mis lainepikkustel mis element valguskiirgust neelab, on võimalik proovis olevaid elemente tuvastada. Gaasifaasi viidud aatomeid kiiritatakse kvantidega, mille tulemusel võivad nad sobiva lainepikkuse korral minna ergastatud olekusse. Neelduva kvandi energ...
My name is //////// and my topic is food microstructure and starch digestion. The presentation is approximately 7-10 minutes long and I will be glad to answer your questions at the end. Slide 2 Starch is important carbohydrate in human diet containing in potatoes, maize, rice, cassava. It is produced by most green plants as energy source. Pure starch is a white, tasteless and odorless powder that is insoluble in cold water or alcohol. It consists of two types of molecules: the linear and helical amylose and the branched amylopectin. Depending on the plant, starch generally contains 20 to 25% amylose and 75 to 80% amylopectin by weight. Glycogen, the glucose store of animals, is a more highly branched version of amylopectin. In industry, starch is converted into sugars, for example by malting, and fermented to produce ethanol in the manufacture of beer, whisky and biofuel. It is processed to produce many of the sugars used in processed foods. The biggest industrial
for maximum efficiency. In shallow water or shore based locations the modules could be fixed directly on the seabed. Location of wave energy converters Modes of movement The technologies for harvesting wave energy can be distinguished depending on the modes of movement which is the use of different degrees of freedom. If waves causes a device to rise and fall vertically is called heaving. The technology to harvest the energy should be able to convert a linear movement into electric energy. The second option is use the horizontally movement backward and forward caused by the waves. That is called surging. The use of rotation about an axis of the device is called pitching technology. Modes of movement of wave energy converters 12 Geometry and orientation of the device Besides their location of installation and the modes of movement wave energy converters can be distinguished by geometry and orientation. Point absorbers
1 0.88 0.8 0.8 0.7 0.6 0.48 0.4 0.27 0.2 0.15 0 0-14 15-29 30-44 45-59 60-74 75-89 90-104 Empiiriline jaotusfunktsioon Linear (Empiiriline jaotusfunktsioon) F(xi)em F(xi)no Vahemik xi ni pi F(xi)rk p rm 0-14 7 9 0,150 0,150 0,07 0,469 15-29 22 7 0,117 0,267 0,22 0,408
4. THD - (total harmonic distortion) Ratio of the rms value of the fundamental signal to the mean value of the RSS of its harmonics. 5. SFDR - (spurious free dynamic range) Ratio of the RMS value of the signal to the RMS value of the worst spurious signal. 6. Channels - related to the inputs of the ADC can either be multiplexed or individually selected. 7. Linearity - relates to how a ADC follows a linear function. All ADCs are to a certain extend nonlinearity. 8. Operating temperature - measurement, which in optimal state for ADC-s, lets them function correctly. 9. Power dissipation - refers to the amount power dissipated when the ADC is operating. Question 2 An 8 bit ADC has a reference voltage of 5V. What is the digital output code word for an input of 1.2V? What is the voltage range corresponding to 1 LSB? 1,2𝑉 0,0195𝑉
sattusid ei olnud piisavalt ja graafikud ei tulnud välja. 8 KOKKUVÕTE Kui soovitakse Pakri + Muuga lahes tagada ,et alamõõdulist kala ei jääks saaki üle 25% , peab minimaalne nakkevõrgu silmasuurus olema 64 mm. Selle sain selektiivsuskõveralt , kus võtsin minimaalseks kala pikkuseks 19mm ( see on ahvena alammõõt) ning vedasin joone kuni 25 % linear jooneni ja lugesin x-teljelt vastava silmasuuruse. Sain 64 millimeetrit. 9 KASUTATUD KIRJANDUS 1. http://www.miksike.ee/documents/main/lisa/3klass/1laheme/ahven.htm 2. http://bio.edu.ee/loomad/Kalad/PERFLU2.htm 3. http://et.wikipedia.org/wiki/Ahven 4. http://y.delfi.ee/norm/108861/5344505_IJgoNl.jpeg 5. A.Järviku materjal ; Loeng 2 ppt, slaid 4
Biomeetria eksamiks ·Konstrueerige sagedustabel tunnusele"hommik" ---- insert PivotTable, joonise tegemisel copy andmed kõrvale (ilma grand total lahtrita) ·Diagrammi kujundamine - kustutada legend ja joonise pealkiri; y-telje põhikoordinaatjooned helehallid katkendlikud; y-teljele nimetus 'Tudengite arv'; x- teljele nimetus 'Mida te tavaliselt hommikul sööte?' ja tõstke see joonise sisse; telgede ühikute kirjasuurus 10 ja nimetustel 12 punkti; y-telje maksimum 29 ja miinimum 0 ühikut ning ühikute vahe (major unit) 5; tulpade vahe 120%; jooniseala (Chart Area) ümbert hall kastijoon kustutada; hall kastijoon teha ümber jooniseala (Plot Area) ·Suhteline sagedus grupi vaatluste arv/kõigi vaatluste arv. Home sakil saab teha protsendiks ·Pidevate arvtunnuste jaoks on vaja klasse. Klasside arvu leiab võttes vaatluste arvust ruutjuure, klassid peavad olema ühepikkuse...
30 20 10 0 September Oktoober November k uu Chart Title 350 300 250 Kokku Linear Regression for Kokku 200 150 100 50 0 September Oktoober November ht eht Kalle Malle Kati Mati Linear Regression for Kokku ber Inventuur mööblipoes Käibemaks 18%
3,5 f(x) = 0,29x + 0,11 Kontsentratsioon ug/ml 3 2,5 R² = 1 2 Konts ug/ml Linear Regression for 1,5 Konts ug/ml 1 0,5 0 1 2 3 4 5 6 7 8 9 10 11 Piigi kõrgus cm
Sele 6.3 Korkkaliiber 6.9 Kasutatud kirjandus ja viited [6.1] Ülesanne 6 – Siledate kaliibrite projekteerimine [6.2] Tabel 5. – Seosed kaliibrite arvutamiseks [6.3] Tabel 6. – Kaliibrite piirhälbed [6.4] Tabel 7. – Harkkaliibri suhtelised mõõtmed [6.5] Tabel 8. – Korkkaliibri suhtelised mõõtmed [6.6] M. Purde. Tolerantsid ja istud. Tln: Tallinna Tehnikakõrgkool, 2005. 116 lk. [6.7] ISO 286-1:2010; Geometrical product specifications (GPS) — ISO code system for tolerances of linear sizes — Part 1: Basis of tolerances, deviations and fits. [6.8] ISO Tolerances for Shafts ISO 286-2:2010
the temperature of the CPU or a motor controller that must know the tem- perature of the power driver IC. Thermistors A thermistor is a temperature-sensitive resistor. Most thermistors have a negative temperature coefficient (NTC), meaning the resistance goes up as temperature goes down. Of all passive temperature measurement sensors, thermistors have the highest sensitivity (resistance change per degree of tem- perature change). Thermistors do not have a linear temperature/resistance curve. Thermistor characteristics are dependent on the manufacturing process and materials used. Often, many thermistors in a family will have similar char- acteristics and identical curves. The resistance of the thermistors may vary by 10 : 1 or 100 : 1, but the curves are the same. Such thermistors are typically characterized by the manufacturer in a table that shows the ratio of resistance at a given temperature to the resistance at 25°C
Roughness profile 4 R3z Base roughness depth Height characterization using the linear material ratio curve ISO13565-2:'96 3Zi is the height of the 3rd height peak from Rk core roughness depth : Depth of the roughness core profile the 3rd depth valley in a sampling length Rr. Rpk reduced peak height : Average height of protruding peaks above roughness core profile.
doos ei ole oluline; realistlikum on ehk teistpidi doos on oluline, ent ravimitüüp mitte. Interaktsioon tähendab aga nt seda, et ravimite efektiivsus sõltub doosist nt ravim1 on efektiivne siis, kui doos on kõrge, ravim2 on aga efektiivne siis, kui doos on madal. Kõigi taoliste faktoriaalsete lahenduste puhul saab SPSS-is kasutada sama lahenduskäiku: Analyze General Linear Model Univariate Kui eeltoodud käsklus on sisestatud, siis on väga palju valikuid. Esmalt määratlege ära sõltuv muutuja ning sõltumatud muutujad (Fixed Factors). - Plots alt pange vanusegrupp horisontaalsele teljele ning sugu olgu eraldi joontena. Vajutage Add ning jätkake. - Post hoc käskluse alt võite valida mõlemad sõltumatud muutujad ning Tukey test. - Options alt valige sõltumatud muutujad ning nende interaktsioon. Display käskluse alt saate valida
Stream function depends on only two Partial differential equations (PDEs) for the scalars and . We win on variables and this is the main advantage. 3. How will change vorticity transport equation if Reynold number will increase? Then Re number increase, it means, that we have turbulent flow. In this conditions Navier-Stokes equation take form of Euler equation. Navier-Stokes equation consist of two parts. One part, that consist volume becomes greater and equation transform into linear. Another part, what consist viscosity, becomes smaller and transform into non-linear term equation. 4. What means asymptotic analysing of the problem? Asymptotic analysing is a method of describing limiting behaviour(boundary conditions). For example in physical system it describes behaviour in very large systems. We use this method then we operate with very high viscosity, much number and so on. 1 5. What gives introducing of Reynolds, Mach and other numbers in Fluid Dynamics?
Since they are polymers, biopolymers contain monomeric units that are covalently bonded to form larger structures. There are three main classes of biopolymers, classified according to the monomeric units used and the structure of the biopolymer formed: 1. polynucleotides (RNA and DNA), which are long polymers composed of 13 or more nucleotide monomers; 2. polypeptides, which are short polymers of amino acids; and 3. polysaccharides, which are often linear bonded polymeric carbohydrate structures Polymers are everywhere The way plastics are made is actually a way of imitating nature, which has created a huge number of polymers. Cellulose, the basic component of plant cell walls is a polymer, and so are all the proteins produced in your body and the proteins you eat. Another famous example of a polymer is DNA - the long molecule in the nuclei of your cells that carries all the genetic information about you.
(koosmõjust). Eeltoodud näite puhul tähendab peaeefekt seda, et nt ainult ravimitüübist oleneb, kas ravi on efekti või ei seevastu ravimi doos ei ole oluline; realistlikum on ehk teistpidi doos on oluline, ent ravimitüüp mitte. Interaktsioon tähendab aga nt seda, et ravimite efektiivsus sõltub doosist nt ravim1 on efektiivne siis, kui doos on kõrge, ravim2 on aga efektiivne siis, kui doos on madal. Käsklusterida: Analyze General Linear Model Univariate Kui eeltoodud käsklus on sisestatud, siis on väga palju valikuid. Esmalt määratlege ära sõltuv muutuja ning sõltumatud muutujad (Fixed Factors). - Plots alt pange vanusegrupp horisontaalsele teljele ning sugu olgu eraldi joontena. Vajutage Add ning jätkake. - Post hoc käskluse alt võite valida mõlemad sõltumatud muutujad ning Tukey test. - Options alt valige sõltumatud muutujad ning nende interaktsioon.
inverter input wave output wave · What are the advantages of a single-phase bridge inverter high efficiency high reliability · What kind of control provides the highest output power of the inverter block · What load inductance provides the interruptible output current zero · What should be the value of an inverter output frequency to reduce audible noise very high · What is the maximum modulation index of a linear PWM system one · What semiconductor devices are most widely used in inverters diode transistor · What is the most important component of a full-bridge inverter transistor · What is delay time of VSI 1 ms · What should be the value of an inverter output frequency to reduce inverter losses very low · What are some applications of CSI heaters welding · Which ac/ac converters change the voltage only voltage regulators · What is obtained as a result of frequency converting new frequency
Parameetrid vaatame
mootorilt.
Tähtis on teada kuidas on mootor ühendatud, kas mootor on täht- või kolmnurk ühendusega.
Selle kontrollimiseks tuleb mootori peal olev kaas lahti kruvida ning vaadata kuidas on
mootori pooluspaarid ühendatud.
1 0,021645022 0,9 e 2,718 0,8 0,7 0,6 Column W 0,5 Linear Regression for 0,4 0,017 0,493347287Column 0,6396373948 W 0,3 40 Column E 0,2 0,1 0
3. Quiz on Electrical Drive Motors and Models 1. What types of motors have the single-sided excitation? -(linear) synchronous 2. What types of motors have the dc excitation? - 3. What types of motors have the permanent magnet excitation? -synchronous, DC 4. What types of motors have the dc supply? -DC, synchronous 5. What types of motors have the slip rings? -induction 6. What types of motors are the brushless motors? -DC, synchronous 7. What orthogonal reference frames do you know? -(,)stator; (d,q)rotor;(x,y)arbitrary 8. What natural reference frames do you know? -3 phase 9. What stationary reference frames do you know? -stator 10. Write the frequency equilibriums that you know. -induction:w1=w2+w12;synchronous:w1=w12;DC:w2=-w12 11. What is the result of the mutual motion of the stator and rotor windings? -torque??? 12. What variables does the flux depend on? -L12 I12? L ja I 13. Write the formulae of the synchronous speed. -2*pii*f1/...
kaugusel Maast. Hayabusa maandub langevarju abil Woomeras, Austraalias. (2) 4 • Sellel pildil on näha Hayabusa kosmoseaparaati. • • 25143 Itokawa 25143 Itokava on Apollo ja Marsiga ristuv asteroid. See on esimene asteroid mis on asteroidi uurimise programmis. Itokawa asteroid avastati 26.septembril 1998. aastal LINEAR programmi käigus. 2000. aastal valiti see Hayabusa missiooni objektiks. Itokawa on S-tüüpi asteroid. S-tüüpi asteroidid on silikaatse (kivise) koostisega ja sellest ka nimi. Ligikaudu 17% asteroididest on seda tüüpi, mistõttu on teiseks kõige levinum peale C-tüüpi. Kuna Itokawa on S-tüüpi asteroid, siis see on mõõdukalt helge ja koosneb peamiselt raua-ja magneesiumi silikaatidest. (3) • Sellel pildil on Hayabusa pealt tehtud pilt 25143 Itokawa-st.
, siis see pole tühi) 4/10/2019 9/25/1972 16998 KÄIVE, 45,000 44057 44,000 43023 43,000 42186 KÄIVE, Linear (KÄIVE, ) 42,000 41256 41,000 40856 40,000 39,000 jaanuar veebruar märts aprill mai 12,000 10,000 8,000 2001 6,000 2002 2003 4,000 2,000 0 Jaanuar Veebruar Märts Aprill Mai Juuni Harjutus 6.1
=0 a^ = xi yi - n x y Sauga, ,,Statistika õpik majanduseriala a^ xi2 - n x 2 üliõpilastele", lisa A.9. Kui CLRM (Classical Linear Regression Model) eeldused on täidetud, annab vähimruutude meetod parima lineaarse nihketa RSS ( a^ , b^ ) = 0 ^ hinnangu (BLUE, Best Linear Unbiased Estimator). b^ b = y - ax ^
Alumine piir Ülemine piir Tulu: 2 112,47 ; 4 663,98 Kulu: 1909,95705 ; 3885,80581 Palk: 3406,73204 ; 8467,7251 Lineaarse Regressiooni sirge võrrand: y = b0+b1*x kus Kulu = f(Tulu) 25 000 f(x) = 0,735478618x + 398,9824244106 20 000 15 000 Kulu Column C Linear Regression for Column C 10 000 5 000 0 0 5 000 10 000 15 000 20 000 25 000 30 000 Tulu x y x*y x^2 TULU KULU KULU*TULU KULU^2 243,40 820,51 199712,134 59 243,56 711,29 677,66 482012,7814 505 933,46
imagery and painting, the English were not yet distinguished in visual arts and religious art was non-existent. The colonial period is almost entirely limited to portraiture (deemed as `useful' by settlers). These first paintings were made by limners and artisans without formal training and were based on what was popular in England during the Tudors. The paintings are technically unskilled, strongly patterned, flat and linear. Spanish painting in America was mostly religious. In C18, painting was a luxury and necessitated wealth that had by then become available. Portraitures remained at the forefront because the rich could thusly display their status and because it was less "frivolous" than other forms of painting. In early-C18, Baroque was imitated (handsome settings, rich chiaroscuro, rich color and painterly execution). Paintings became gradually more elaborate
imagery and painting, the English were not yet distinguished in visual arts and religious art was non-existent. The colonial period is almost entirely limited to portraiture (deemed as `useful' by settlers). These first paintings were made by limners and artisans without formal training and were based on what was popular in England during the Tudors. The paintings are technically unskilled, strongly patterned, flat and linear. Spanish painting in America was mostly religious. In C18, painting was a luxury and necessitated wealth that had by then become available. Portraitures remained at the forefront because the rich could thusly display their status and because it was less "frivolous" than other forms of painting. In early-C18, Baroque was imitated (handsome settings, rich chiaroscuro, rich color and painterly execution). Paintings became gradually more elaborate
leida erinevad ajupiirkonnad, milles on täheldatavad sünkroonsed BOLD-signaali kõikumised patsiendi puhkeolekus Puhkeoleku fMRT · Puhkeoleku fMRT roll tulevikus on diagnostilise ja prognostilise teabe kogumine neuroloogiliste ja psühhiaatriliste haiguste korral · Kirurgiline planeerimine patsientidel, kellel on epilepsia · Alzheimeri tõve identifitseerimine patsientidel Tarkvara Kaks põhimudelit · GLM general linear model Matemaatiliselt sama mis mitmene regressioonanalüüs (mitmete kvalitatiivsete ja mitmete kvantitatiivsete muutujatega) · ICA independent components analysis Koosneb ruumiliselt kattuvatest komponenditest, kus iga komponent sõltumatu ruumilise mustriga ja erineva aja käiguga · Etapid: eeltöötlus (preprocessing) Ruumiline ja ajaline eeltöötlus Ruumiline normimine
the Renaissance. "The rebirth" from French Renaissance, meaning "rebirth"; Italian: Rinascimento, from re- "again" and nascere "be born") Rebirth of scholarship based on classical learning and philosophy. The Renaissance was a cultural movement that spanned roughly the 14th to the 17th century, beginning in Italy in the late Middle Ages and later spreading to the rest of Europe. It encompassed a revival of learning based on classical sources, the development of linear perspective in painting, and gradual but widespread educational reform. (wikipedia)Bridge between Medieval Ages and Modern Era. 2. Where did the Renaissance start and why? In the opening years of the 14th century, there began to develop in Italy and increasing interest in the manuscripts that had survived from ancient Greece and Rome. Italy fell under the spell of the intellectual movement we've come to call the
48 and %GC = 53.00) CpG island detected in region 850 to 1049 (Obs/Exp = 1.47 and %GC = 53.00) CpG island detected in region 851 to 1050 (Obs/Exp = 1.46 and %GC = 53.00) CpG island detected in region 852 to 1051 (Obs/Exp = 1.49 and %GC = 52.50) CpG island detected in region 853 to 1052 (Obs/Exp = 1.47 and %GC = 53.00) CpG island detected in region 854 to 1053 (Obs/Exp = 1.49 and %GC = 52.50) 3) Mutate for Digest Mutate for Digest results mutated sequence current sequence Results for linear 1053 residue sequence "eco:b2097 fbaB, dhnA; fructose-bisphosphate aldolase class I [EC:4.1.2.13]; K01623 fructose-bisphosphate aldolase, class I (N)" starting "atgacagata" 1M T D I A Q L L G K D A D N L L Q H R C 1M T D I A Q L L G K D A D N L L Q H R C 1 atgacagatattgcgcagttgcttggcaaagacgccgacaaccttttacagcaccgttgt 1 atgacagatattgcgcagttgcttggcaaagacgccgacaaccttttacagcaccgttgt 21 M T I P S D Q L Y L P G H D Y V D R V M 21 M T I P S D Q L Y L P G H D Y V D R V M
Prognoos 60000 40000 20000 0 2012 2013 2014 2015 -20000 -40000 BRUTOKASUM ÄRIKASUM KASUM ENNE TULUMAKSU ARUANDEAASTA PUHASKASUM Linear (ARUANDEAASTA PUHASKASUM) Pilt nr. 3 Aruandeaasta puhaskasumi prognoos 2016.aastaks Kuna täpsemat prognoosi ei oska teha, siia on toodud 2016. aastaks puhaskasumi ligikaudne prognoos. On näha, et ettevõtte kasum mingil põhjusel miinuses ehk siis see on kahjum. 5 Turunduse edendamise võimalused VKG koosneb kaheksast ettevõttest – emaettevõttest ja selle ainuomandisse kuuluvast seitsmest tütarettevõttest
· Jagunevad: · kiirekäigulised ja madalamomendilised mootorid n=1000...4000 p/min · Aeglasekäigulised ja suuremomendilised mootorid n=0...500 p/min · 13. Hüdrosilindrid. Kolvivarre nõtkumine e pikipainde · Hüdrosilindri ülesandeks on vedeliku hüdraulilise energia muutmine kolvi sirgjoonelise liikumise mehaaniliseks energiaks (i.k termin hydraulic cylinder, linear actuator). · Leiavad kasutamist mitmesuguste kulgevate liikumiste realiseerimiseks · Põhilised silindrite tüübid: · Ühepoolse toimega silindrid · Kahepoolse toimega silindrid · Ühepoolse toimega silindrid töökäik hüdraulilise energia arvelt, tagasikäik raskusjõu või siis tagastusvedru toimel. Kasutatakse kui kolvi tagasiliikumisel on takistus väike. Juhtimiseks võib kasutada odavamaid seadmeid (3/2 jaotur)
apr.08 5 8,65 52 mai.08 7 7,59 53 juuni.08 20 15,97 54 juuli.08 12 10,90 55 aug.08 10 8,16 56 sept.08 14 11,43 57 okt.08 13 12,77 58 nov.08 14 12,56 59 dets.08 5 4,18 60 Lahutused ja ilma sessoonsuseta 500 400 Lahutused Ilma sessoonsuseta 300 Linear Regression for Ilma sessoonsuseta 200 100 0 1 5 9 13 17 21 25 29 33 37 41 45 49 53 57 SUMMARY OUTPUT Regression Statistics Multiple R 0,4266894 R Square 0,1820639 Adjusted R Square 0,1679615 Standard Error 36,134229 Observations 60 ANOVA df SS MS F Significance F Regression 1 16856,6 16856,6 12,91018 0,000675
the output signal-tonoise ration - The amount of noise introduced by the active system/device 49. Milleks kasutatakse kanalikodeerimist? Channel coding enables the receiver to detect and correct errors, if they occur during transmission due to noise, interference and fading. 50. Mis on genereeriv maatriks ja paarsuskontrolli maatriks? Genereeriv maatriks – In coding theory, a generator matrix is a matrix whose rows form a basis for a linear code. The codewords are all of the linear combinations of the rows of this matrix, that is, the linear code is the row space of its generator matrix. Paarsuskontrolli maatriks - Duaalne ruum (n, k) koodi C dimensiooniga k on koodi (n, n − k) C duaalne kood, mida tähistatakse kui C⊥. Kood C, mille puhul kehtib C = C⊥ nimetatakse ise duaalseks koodiks (self-dual code) In coding theory, a parity-check matrix of a linear block code C is a matrix which
annaabi.ee 
Sisene Facebook'ga
Sisene Google'ga
Sisene LinkedIn'ga
