in armed conflict in its colony of Portuguese India against the Indian Armed Forces. The operations resulted in the defeat of the limited Portuguese defensive garrison, which was forced to surrender to a much larger military force. The outcome was the loss of the remaining Portuguese territories in the Indian subcontinent. The Portuguese regime refused to recognize Indian sovereignty over the annexed territories, which continued to be represented in Portugal's National Assembly until the military coup of 1974. Also in the early 1960s, independence movements in the Portuguese overseas provinces of Angola, Mozambique and Guinea in Africa, resulted in the Portuguese Colonial War (1961 1974). REVOLUTION AND COLONIAL END Throughout the colonial war period Portugal had to deal with increasing dissent, arms embargoes and other punitive sanctions imposed by most of the international community.
1936: Churchi lambda-arvutus, Churchi tees. universaalsus, mittelahenduvus straightforward to operate MIT: 1930-1935-1937: Differential Analyzer dif. võrrandite lahendamiseks 1977 - The Apple II became an instant success when released in 1977 with its (VANNEVAR BUSH) printed circuit motherboard, switching power supply, keyboard, case assembly, Claude SHANNON - MIT, 1938, Shannon'i magistritöö sidus:, Boole algebra, manual, game paddles, A/C powercord, and cassette tape with the computer Elektrilülitid ja -skeemid , Bitid ja info kodeerimine, Info otsimise algoritmid game "Breakout. Konrad Zuse - Programmeeritavate arvutite pioneer saksamaalt , 1936-38: Z1: 1979 - Harvard MBA candidate Daniel Bricklin and programmer Robert
Juba mõne aasta möödudes, 1987, avaldas Microsoft uue Windowsi versiooni -2.0, mis tõi küllaltki vähe muutusi. Peamiseks uuenduseks olid kattuvad aknad ja keerukamate kiirklahvide teke. Alles 1990. aastal välja lastud Windows 3 täiustas kasutajaliidest ja disaini. See sai võimalikuks tänu arendatud virtuaalsele mälule ning virtuaalsetele draiveritele. Palju veaohtlikke operatsioone kirjutati C-st ümber assembly keelde. Windows 3 oli Windows'ide esimene suur edu, poole aasta jooksul müüdi üle maailma enam kui 2 miljonit koopiat. 1995. aastal avaldas Windows järgmise operatsioonisüsteemi Windows 95, 1998. aastal Windows 98. Windows 95 oli revolutsiooniline toode, see polnud mõeldud asendama mitte ainult Windows 3, vaid kogu Windowsi perekonda ja lisaks veel MS-DOS'i. Samuti uuendati töölauda, mille disainist sai Windowsi klassika. 1995. aastal
Country Study Mari-Liis Luukas 11c The British Isles Administrative / d'mnstrtv / haldus- Self-governing / self'gvn / isemajandav, iseseisev Legislative assembly/ 'ledsltv 'sembl/ seadusandlik kogu The British Isles is the name of a group of islands washed by the North Sea in the east and the ...
.. I'd like to know ... ANSWERS Go ahead/Please do/Certainly. That's a good question. That's interesting. Statement questions and answers QUESTIONS All the space was booked for an October launch ...? (question intonation) It worries me that we don't have any replacements in the pipeline. Doesn't it worry you too? ANSWERS A positive statement question is looking for the answer 'yes': lt's going to be late, isn't it? ~ I'm afraid so. You've got problems with the assembly? ~ Yes, a few. The suppliers have done their job. Is that right? ~ Yes, as far as I know. A negative statement question is looking for the answer 'no': We haven't won the contract, have we? ~ No, it doesn't look like it. I wasn't a success? Not much of one. We aren't going to make it on time, are we? ~ I'm afraid not. If the answer contradicts the statement, the word 'actually' is often used:The plant's going to close, isn't it
There are civil and criminal appeals courts, the highest being the Court of Cassation. Separate state security courts have jurisdiction over activities affecting the security of the government. In addition, Shari'ah courts apply Islamic law in cases involving personal status. The Druze and non- Muslim communities have their own religious courts. A Supreme Constitutional Court investigates and rules on petitions submitted by the president or one-fourth of the members of the People's Assembly challenging the constitutionality of laws or legislative decrees. This court has no jurisdiction to hear appeals for cases from the civil or criminal courts. The constitution provides for an independent judiciary. The regular court system is independent; however, the state security courts are not completely independent from the executive. There are no jury trials. The regular courts respect constitutional provisions safeguarding due process. The Supreme State Security
vorrandite lahendamiseks I 9ti I - IBM PC, 3z(XX) - csinlcne 3z-bil prosc (Nrtional Senriconducror). loodi SUN ja Courprq (VANNEVAR BUSH) printed circuit mothsboard. switching pwer supply, keyboard' case assembly Claude SHANNON - MlT, 1938, Shahnon'i magistrit66 sld6:, Eoole algebra' manual, game paddles, l,/C powqcord, and cassette tape wrth the cmputer * C#. game "Breakout. I9lt3 turbo pascrl.
KORDAMISKÜSIMUSED kevad 2009 NB! Allolevad kordamisküsimused ei vasta üks-üheselt nendele, mis tulevad eksamil, vaid pigem annavad ette need teemad-aspektid, millele tuleks materjali läbitöötamisel eelkõige keskenduda. (1) Euroopa Liidu kujunemine ja lepingud, EL 'idalaienemine', Eesti integratsioon Euroopa Liitu, EL õiguslikud alused 1. Peale II maailmasõda Euroopa integratsiooni tinginud peamised faktorid EL tekkimise eeldused (vajadus) * II maailmasõja järgne majanduslik ülesehitustöö * Vajadus rahu kindlustamiseks ja poliitilise stabiilsuse tagamiseks Euroopas * Nn "Saksamaa küsimus" (vajadus rahumeelseks kaasamiseks, k.a. kommunismivastasesse võitlusse; soov välistada Saksamaa varjatud taasrelvastumine) * Vajadus vastu seista NSVL ekspansionismile; kartus kommunismi levimise eest Lääne-Euroopasse * USA sekkumine: soov ja huvi luua jõukas, rahumeelne ja ühendatud Euroopa (esialgu Lääne-Euroopa) 2. Poliitilise koostöö peamised tä...
KORDAMISKÜSIMUSED kevad 2009 NB! Allolevad kordamisküsimused ei vasta üks-üheselt nendele, mis tulevad eksamil, vaid pigem annavad ette need teemad-aspektid, millele tuleks materjali läbitöötamisel eelkõige keskenduda. (1) Euroopa Liidu kujunemine ja lepingud, EL 'idalaienemine', Eesti integratsioon Euroopa Liitu, EL õiguslikud alused 1. Peale II maailmasõda Euroopa integratsiooni tinginud peamised faktorid EL tekkimise eeldused (vajadus) * II maailmasõja järgne majanduslik ülesehitustöö * Vajadus rahu kindlustamiseks ja poliitilise stabiilsuse tagamiseks Euroopas * Nn "Saksamaa küsimus" (vajadus rahumeelseks kaasamiseks, k.a. kommunismivastasesse võitlusse; soov välistada Saksamaa varjatud taasrelvastumine) * Vajadus vastu seista NSVL ekspansionismile; kartus kommunismi levimise eest Lääne-Euroopasse * USA sekkumine: soov ja huvi luua jõukas, rahumeelne ja ühendatud Euroopa (esialgu Lääne-Euroopa) 2. Poliitilise koostöö peamised tä...
KORDAMISKÜSIMUSED kevad 2009 NB! Allolevad kordamisküsimused ei vasta üks-üheselt nendele, mis tulevad eksamil, vaid pigem annavad ette need teemad-aspektid, millele tuleks materjali läbitöötamisel eelkõige keskenduda. (1) Euroopa Liidu kujunemine ja lepingud, EL 'idalaienemine', Eesti integratsioon Euroopa Liitu, EL õiguslikud alused 1. Peale II maailmasõda Euroopa integratsiooni tinginud peamised faktorid EL tekkimise eeldused (vajadus) * II maailmasõja järgne majanduslik ülesehitustöö * Vajadus rahu kindlustamiseks ja poliitilise stabiilsuse tagamiseks Euroopas * Nn "Saksamaa küsimus" (vajadus rahumeelseks kaasamiseks, k.a. kommunismivastasesse võitlusse; soov välistada Saksamaa varjatud taasrelvastumine) * Vajadus vastu seista NSVL ekspansionismile; kartus kommunismi levimise eest Lääne-Euroopasse * USA sekkumine: soov ja huvi luua jõukas, rahumeelne ja ühendatud Euroopa (esialgu Lääne-Euroopa) 2. Poliitilise koostöö peamised tä...
KORDAMISKÜSIMUSED kevad 2009 NB! Allolevad kordamisküsimused ei vasta üks-üheselt nendele, mis tulevad eksamil, vaid pigem annavad ette need teemad-aspektid, millele tuleks materjali läbitöötamisel eelkõige keskenduda. (1) Euroopa Liidu kujunemine ja lepingud, EL ’idalaienemine’, Eesti integratsioon Euroopa Liitu, EL õiguslikud alused 1. Peale II maailmasõda Euroopa integratsiooni tinginud peamised faktorid EL tekkimise eeldused (vajadus) * II maailmasõja järgne majanduslik ülesehitustöö * Vajadus rahu kindlustamiseks ja poliitilise stabiilsuse tagamiseks Euroopas * Nn “Saksamaa küsimus” (vajadus rahumeelseks kaasamiseks, k.a. kommunismivastasesse võitlusse; soov välistada Saksamaa varjatud taasrelvastumine) * Vajadus vastu seista NSVL ekspansionismile; kartus kommunismi levimise eest Lääne-Euroopasse * USA sekkumine: soov ja huvi luua jõukas, rahumeelne ja ühendatud Euroopa (esialgu Lääne-Euroopa) 2. Poliitilise koostöö peamised tä...
Motherboard - the principle printed circuit board assembly in a computer; includes core logic (chipset), interface sockets and/or slots, and input/output (I/O) ports. Printed circuit board (PCB) - a thin, laminated sheet composed of a series of epoxy resin and copper layers and etched electronic circuits (signal, ground and power) Chipset (or core logic) - two or more integrated circuits which control the interfaces between the system processor, RAM, I/O devises, and adapter cards. Processor slot/socket - the slot or socket used to mount the system processor on the motherboard AGP - Accelerated Graphics Port - a high speed interface for video cards; runs at 1X (66MHz), 2X (133MHz), or 4X (266MHz). PCI - Peripheral Component Interconnect - a high speed interface for video cards, sound cards, network interface cards, and modems; runs at 33MHz. ISA - Industry Standard Architecture - a relatively low speed interface primarily used for sound...
Lühike Õpetus Programmeerimine AVR ilma Arduino Motivatsioon Lihtsalt alustada valest otsast: "mõnikord Arduino on vale valik." Sõltuvalt sellest, mida sa teed, äkki te app struktuur ei ole väga hästi sobib Arduino raamistik. Võib-olla teil on vaja kirjutada väiksema kood see, mida oleks võimalik toota Arduino, mõnikord sa lihtsalt ei suuda Arduino üldse ... Ma olen selle viimase kategooria. Ma ei ole nii suur fänn Java, ja ma olen rahul, tekstiredaktor ja sõidu koostaja käsitsi, nii et ma teen selle raske tee. Arduino trowels mõne kena krohv üle top, kuid see on mi mida sa ei saa seda teha käsitsi. Tõesti, kõik, mida peaks vaja on avr-gcc, avr-libc, avr-binutils ja AVRDude. Kuidas need paketid on väljapoole käesoleva dokumendi, siis on üsna tõenäoline, on pre-ehi paketid oma OS. See dokument on kirjutatud anda algteadmised mõned spetsiifikat AVR programmeerimine, eeldades, et juba on käepide, C. See lähendab et ma tulin, et mõista a...
EUROOPA LIIDU PÕHIKURSUS KORDAMISKÜSIMUSED KEVAD 2014 NB! Allolevad kordamisküsimused ei vasta üks-üheselt nendele, mis tulevad eksamil, vaid pigem annavad ette need teemad-aspektid, millele tuleks materjali läbitöötamisel eelkõige keskenduda. (1) EUROOPA LIIDU KUJUNEMINE JA LEPINGUD, EL 'IDALAIENEMINE', EESTI INTEGRATSIOON EUROOPA LIITU, EL ÕIGUSLIKUD ALUSED EL AJALOOLINE KUJUNEMINE 1. Peale II maailmasõda Euroopa integratsiooni tinginud peamised faktorid · Poliitilised pinged ja ebastabiilsus; rivaliteet ja vastandlikud huvid; majanduslik madalseis · EL tekkimise eeldused (vajadus) o II maailmasõja järgne majanduslik ülesehitustöö o Vajadus rahu kindlustamiseks ja poliitilise stabiilsuse tagamiseks Euroopas o Nn "Saksamaa küsimus" (vajadus rahumeelseks kaasamiseks, k.a. kommunismivastasesse võitlusse; soov välistada Saksamaa varjatud taasrelvastumine) o Vajadu...
remembered by Russians. In the Middle Ages that part of Toompea where the castle stands was called the Small Fortress. The rest of the hill with the homes of the feudal lords and bishop of Tallinn was called the Big Fortress. The main building, the centre of the Small Fortress, was the Convention House- a building where the members of the knighthood lived. In the 1920s the reconstruction of the building was carried out. The northern part of it became the seat of the State Assembly of the Estonian Republic. In the 19th century a public garden was laid out the Governor's Garden. Town Wall and its Towers The first town wall of Tallinn, which was rather low and modest, was built in the second half of the 13th century. It was called Margaret's Wall by the Danish queen Margaret in 1265. In 1310 Johan Canne was appointed Viceregent of Tallinn and he started the re- construction of the wall, known as Canne Wall. The wall was completed by 1355. The wall was 6
resuscitated Magical Burger King character. History Burger King's first restaurant, originally called Insta Burger King, was opened on December 4, 1954 in a suburb of Miami, Florida by James McLamore and David Edgerton; both alumni of the Cornell University School of Hotel Administration. McLamore visited the original McDonald's hamburger stand belonging to Dick and Mac McDonald in San Bernardino, California; sensing potential in their innovative assembly line-based production system, he decided to create a version of his own. By 1959, BK had grown to five regional stores in and around the metropolitan Miami area. About this time, McLamore and Edgerton decided to expand BK nationally by using a franchising system; a popular method for expansion due to its low capital cost for the parent company. They formed Burger King Corporation as the parent and began selling territorial franchise licenses to private owners across the US.
1. Mõisted sisenev (sisend-) logistika- Materjalide ja toodete liikumine tarnijatelt ja müüjatelt tootmisprotsessi või ladudesse nähtuna kaubasaaja vaatepunktist. Hõlmab ettevõtte hanke- ja ostutegevust, materjalide ja valmistoodete mahalaadimist laos, vastuvõtukontrolli ja vajadusel lahtipakkimist, hoiuühikute koostamist ning hoiukohtadele paigutamist. Ostmine- Osa sisendlogistikast. Protsessid ning tegevused [ostmine], mille tulemusena saavad ettevõtted oma tegutsemiseks vajalikke materiaalseid vahendeid (kaubad, materjalid) ja teenuseid. Hankimine- Strateegiline hankimine/ostmine ehk tarnijate juhtimine.. Hankimine = tarnijate juhtimine (strateegiline hankimine/ostmine) + ostmine hankelogistika- on tooraine, pooltoodete, detailide, sõlmede ja muu tootmiseks vajalike materjalide tõhus teisaldamine lähtepunktist tootmiskohta, tagades ostjale (tootjale) ajalis-ruumilise kasulikkuse. Hankelogistika: k...
After TFIID binds to the TATA box via the TBP, five more transcription factors and RNA polymerase combine around the TATA box in a series of stages to form a preinitiation complex. One transcription factor, DNA helicase, has helicase activity and so is involved in the separating of opposing strands of double-stranded DNA to provide access to a single-stranded DNA template. After transcription factors are attached to the promoter does the RNA polymerase bind to it. The completed assembly of transcription factors and RNA polymerase bind to the promoter, forming a transcription initiation complex. 3. Raku organellide funktsioonid. · mitokonder 2 membraani (sisemembraani sopistised kristad), oma DNA (väike, sageli muutuv, pärandub emaliini pidi). Raku hingamine, toitainete lagundamine (ensüümide ja hapniku abil), moodustub vesi, süsihappegaas, energia ATP kujul.
C# õppematerjal 2006 Sisukord Sisukord...................................................................................................................................... 2 Sissejuhatus.................................................................................................................................5 Põhivõimalused...........................................................................................................................6 Käivitamine.............................................................................................................................8 Ülesandeid...........................................................................................................................9 Suhtlus arvutiga.......................................................................................................................9 Arvutamine......................................................
common) and then it is stored in the form of image RAW that is the negative of the photograph Image Sensor The image sensor converts the optical image to an electronic signal, which is then sent to your memory card. There are two main types of image sensors that are used in most digital cameras: CMOS and CCD. Both forms of the sensor accomplish the same task, but each has a different method of performance. xLens - A proper term for this part should be Lens Assembly, this consists of several layers of lenses of varying properties providing zoom, focusing, and distortion correction. These lenses are mechanically interconnected and adjustment is controlled either manually or electronically through the camera's body, Are made of high-quality glass. xThe objective - It is a set of lenses, whose function is to form the image that will capture the sensor. Focal length: determines the coverage angle and lens magnification factor.
Tallinn English College Topic Estonia Tallinn 2008 1. Introduction Estonia is a small country about the size of Switzerland, or New Hampshire and Massachussetts combined. Estonia is named after the people called "Ests" who lived in the region in the 1 st century AD. The Republic of Estonia is one of the three countries commonly known as the "Baltic States". The other Baltic States are Latvia and Lithuania. 2. Geographical position Estonia is situated in northeastern Europe. Estonia is bounded on the north by the Gulf of Finland, on the east by Russia, on the south by Latvia and on the west by the Baltic Sea. In the north it borders on Finland. The coastline of the Baltic Sea in Estonia is characterized by numerous gulfs and bays, the biggest of them being the Gulf of Finland, the Gulf of Riga and the Gulf of Pärnu. Bays include the Narva Bay, Matsalu Bay, Kolga Bay, Kunda Bay, Tallinn Bay etc....
... (1st searche peace and if you cant find it search war) XV Those who recive gifts should be grateful each person should try to accomodae themselves to others(compleasance) One should pardon others(unless its dangerous to do so) When taking revenge, one should look to the future, not the past. None should declare hatred or ontempt for others Part Two: Of Commonwealth I authorise and give up my right of governing myself to this man, or to this assembly of men, on this condition; that thou give up, thy right to him, and authorise all his actions in like manner. Death of the king (charles I) XVII Convenant w/o the sword are but words" A nation will fight with another nation, but once there is peace they will fall back into fighting among themselves The state is mortal god *The soveregin can do no injury to the individual because he has delegated authoroty to him *The sovereign has the right to ban books in the intrest of peace
pärast vormi valamist eemaldatakse: a. Vormikastid asendatakse õhukeseseinalise vormiümbrisega. b. Vertikaalse lahutuspinnaga vormid vormitakse pöörduvate plaatidega vormimasinal. 3. Virnvormimise (stack moulding) vorm koosneb mitmest eraldi vormitud osas mida toidab üks valukanal ja seob ühine püstkanal. Kasutatakse lihtsakujuliste valandite puhul. 4. Kärnvormimine (core assembly moulding) vorm koostatakse kärnidest , mis moodustavad nii valandi sise kui ka välispinnad. Kasutatakse keeruliste valandite tootmiseks. 5. Vaakumvormid (vacuum moulding) sideaineta, kasutatakse kuiva liiva , mida hoitakse ja tihendataske vomikastis polümeerkile ja vaakumi abil. Kuiv- ja märgvormimine: Märgvormimine (green-sand moulding) puhul kuivatatakse ainult kärn Kuivvormimise (dry-sand moulding) korral kuivatatakse enne koostamist kõik
KORDAMISKÜSIMUSED 2013 Tugineb föderalistlikule teooriale, mille kohaselt integratsiooni 1. Euroopa Liidu kujunemine ja lepingud, EL ,,idalaienemine", lõpptulemusena tuleks luua ühtne föderatiivne riik ja kaotada Eesti integratsioon Euroopa Liitu, EL õiguslikud alused rahvuste vahelised piirid. Riikideülesuse põhimõte leiab, et riigid ei suuda iseseisvalt täita kõiki funktsioone, mis on vajalikud 1. Peale II maailmasõda Euroopa integratsiooni tinginud kodanikele avalike hüvede pakkumiseks. Globaliseeruvas peamised faktorid. maailmas on teatud ülesandeid efektiivsem täita riikideükesuse EL tekkimise eeldused (vajadused): põhimõttel. *II maailmasõja järgne majanduslik ülesehtustöö 9. Euroopa Majandusühendu...
MEGABLAST, BLAST 2 sequences jt programme (http://www.ncbi.nlm.nih.gov/) (3) "CpG island"i identifitseerimine inimese kromosoomis (BLAT programm, http://genome.ucsc.edu/cgi-bin/hgBlat) 109 nukleotiidi CCGCGGGTCGGCGGGGAGGTTGGGCCCAGGGATAAAAGAACTGGGGCTGGTGGGGGGGA GGGGTTCCCGGCCTAGGGGAAGGGCTATGACAATGGAATGACAACCGCGG Homo sapiens chromosome 15 genomic scaffold, alternate assembly CHM1_1.0 Sequence ID: ref|NW_004078084.1|Length: 73034944Number of Matches: 1 Related Information Map Vieweraligned genomic context Range 1: 36420564 to 36420672 GenBank Graphics Score Expect Identities Gaps Strand
vaieldavaks aastakümneteks pärast Ühendriikide põhiseaduse väljatöötamist 1787. aastal. Ameerika föderatsiooni areng pole Euroopa Liidu uurimisel õpetlik mitte seetõttu, et visandaks mingi paratamatu või (eba)soovitava integratsioonitrajektoori, mille abil ennustada liidu tulevikku, vaid kuna annab aimu, 26 M. Varju. Hungary. On the Constitutional Issues of EU Membership and the Interplay between the ECHR and Domestic Constitutional Law Concerning the Right of Assembly and Freedom of Expression. – European Public Law 2009 (15), lk 300. 27 Hea sissejuhatuse sellesse teemasse võib leida raamatust: O. Beaud. Théorie de la fédération. Paris: PUF 2007. 28 M. Seydel. Der Bundesstaatsbegriff. – Zeitschrift für die gesamte Staatswissenschaft. Band 28. 1872, lk 195. 29 Vt nt S. Brie. Der Bundesstaat. Eine logisch-dogmatische Untersuchung. Erste Abtheilung. Leipzig: Verlag von Wilhelm Engelmann 1874, lk 193
[16] As the first painter to take as his idiom the imagery of the machine age, and to make the objects of consumer society the subjects of his paintings, Léger has been called a progenitor of Pop art.[17] He was active as a teacher for many years. Among his pupils were Nadir Afonso, Robert Colescott, Charlotte Gilbertson, Hananiah Harari, Asger Jorn, Beverly Pepper, Victor Reinganum, Marcel Mouly and George L. K. Morris. In 1952, a pair of Léger murals was installed in the General Assembly Hall of the United Nations headquarters in New York, New York. In 1960, the Musée Fernand Léger was opened in Biot, Alpes-Maritimes,France. In November 2003, his painting, La femme en rouge et vert sold for $22,407,500 United States dollars. His sculptures have been selling in excess of 8 million dollars. In August 2008, one of Léger's paintings owned by Wellesley College's Davis Museum, Mother and Child, was reported missing. It is believed to have disappeared some time
- Pere kokkuvarisemise hälve kui mesilaste surmade põhjustaja Referaat Koostaja: - Juhendaja: - - Sisukord Sissejuhatus..................................................................................................................3 1.Sümptomid................................................................................................................4 2.Hälbe ulatus ............................................................................................................5 3.Võimalikud põhjused................................................................................................6 3.1Alatoitumine.........................................................................................................6 3.2 Patogeenid ja i...
I loeng EUROOPA LIIDU AJALOOLINE KUJUNEMINE ehk EUROOPA INTEGRATSIOONI KRONOLOOGIA Sissejuhatus: · Mis asi on Euroopa Liit ühine raha; inimeste vaba liikumine, teenuste vaba liikumine, kaupade vaba liikumine, kapitali vaba liikumine; · Mingi hulk riike on kasvanud üksteisega kokku, see on suur protsess. · Euroopa nõukogu, parlament, kohus, erinevad komiteed jne. · Euroopa Liit on loodud teatud eesmärkide saavutamiseks. On palju plusse ja miinuseid. Väga raske on määratleda, kas on negatiivne või positiivne. · Millal sai alguse EL? Konksuga küsimus. Euroopa liidul pole ühtset sünnidaatumit. Areng on etapiviisile. Sõjajärgne periood. 1952 esimene oluline daatum loodi Söe ja Teraseühendus. Väga tähtis. 9 Mai on Eurooopa päev 1950 kuulutati see idee välja, Prantsuse välisminister ütles, et neil Saksamaaga on plaan luua midagi sellist. 1958 Rooma Leping loodi EL m...
sealing rings are fitted. 4. Clean the cylinder liner, removing the protective layer of the grease, and mount new sealing rings. Coat the sealing rings with a little grease. The joint surfaces must be quite clean and the contact surfaces of the cylinder liner must be filled up with paste to prevent corrosion. 5. Mount the four lifting screws in the new cooling jacket cylinder liner. Hook the lifting tool and lift the jacket/liner assembly into position the cylinder frame. 6. The six non-return valves are to be mounted in the bores of the liner. Screw the pipes from the lubricator on to the non-return valves, but do not tighten. Vent the cylinder lubricating system by manually pumping until oil, without air bubbles, comes out from the non-return valves. When this is in order, tighten the pipes firmly on the non-return valves and again pump manually. Place a new sealing ring on top of the cylinder liner.
Referaat Liis Pibre ÜRO ajaloost Ühinenud Rahvaste Organisatsioon (ÜRO) on praeguseks 191 riiki ühendav ülemaailmne organisatsioon, mille laia tegevusvaldkonda kuuluvad nii rahu ja julgeoleku, arengu kui ka inimõigusküsimused. ÜRO tegevuse alguskuupäevaks võib lugeda 24. oktoobrit 1945, mil jõustus ÜRO põhikiri. Ühinenud Rahvaste Organisatsioon asutati asendamaks Esimese maailmasõja järel loodud Rahvasteliitu (League of Nations), mis ei olnud suutnud täita talle pandud lootusi rahvusvahelise rahu ja julgeoleku säilitamisel ega ka edukalt kaasata oma liikmeskonda kõiki rahvusvahelisi suurvõime. Üheks esimestest sammudest uue rahvusvahelise organisatsiooni loomisel oli 14. augustil 1941 USA presidendi F. D. Roosevelti ja Suurbritannia peaministri W. Churchilli avaldatud Atlandi Harta (Atlantic Charter ), mis sisaldas nägemist sõjajärgsest rahvusvahelisest julgeoleku...
Andmebaasipõhiste veebirakenduste arendamine Microsoft Visual Studio ja SQL Server'i baasil C# Tallinn 2011 C# Mõnigi võib ohata, et jälle üks uus programmeerimiskeel siia ilma välja mõeldud. Teine jälle rõõmustab, et midagi uut ja huvitavat sünnib. Kolmas aga hakkas äsja veebilahendusi kirjutama ja sai mõnegi ilusa näite lihtsasti kokku. Oma soovide arvutile selgemaks tegemise juures läheb varsti vaja teada, "mis karul kõhus on", et oleks võimalik täpsemalt öelda, mida ja kuidas masin tegema peaks. Loodetavasti on järgnevatel lehekülgedel kõigile siia sattunute jaoks midagi sobivat. Mis liialt lihtne ja igav tundub, sellest saab kiiresti üle lapata. Mis esimesel pilgul paistab arusaamatu, kuid siiski vajalik, seda tasub teist korda lugeda. Ning polegi loota, et kõik kohe lennult külge jääks!? Selle jaoks on teksti sees koodinäited, mida saab kopeerida ja arvutis tööle panna....
Veapunktisüsteemi mudeli rakendamine ja rehabilitatsioonisüsteemi väljatöötamine (jätku-uuring) Tallinn 2010 Sisukord Sissejuhatus.................................................................................................................................3 1. Mõisted ...................................................................................................................................6 2. Veapunktisüsteemi olemus ja ülesehitus ................................................................................7 2.1. Veapunktide määramine ja kehtivusaeg .....................................................................9 2.2. Veapunktisüsteemi juriidilised aspektid ja sobitumine õiguskeskkonda..................11 2.3. Veapunktisüsteemi administreerimine......................................................................14 3. Liiklusreegleid rikkunud juhtide rehabilitatsio...
MSIL=Microsoft Intermediate language(between compiler and JIT) JIT=Just in Time compiling. Part of data compile only in run-time when it is needed.Loader creates stub for every method.After,querys go to mashinecode.Convert verification-safe code. Assembly is a partially compiled code library for use in deployment, versioning and security. Two types, process assemblies (EXE) and library assemblies (DLL). Process assembly use classes from library assemblies. Summary:assembly=component;MS computing distributes among servers and clients via .Net assemblies; .NET more versatile than DCOM+; Asseblies interoperable among MS languages. 4. Relationships I Association (Models a semantic connection among classes) – Aggregation (A special form of association that models a whole-part relationship between an aggregate (the whole) and its parts)
Pahad ehk gallid on taimekudede paiksest haiguslikust vohamisest tekkinud väärmoodustised. Neid põhjustavad ärritavad ained, mida eritavad taimekahjurid- pahklestad, pahksääsed, pahkvaablased, pahktäid ning mõned patogeensed seened ja bakterid. Allelopaatia- ühe taime negatiivne mõju teisele keemilise mõjuaine vahendusel. Allokatsioon- piiratud ressursside jaotamine või suunamine niisugustesse kohtadesse, kus neid saab kasutada kõige tõhusamalt ja tulusamalt. Ansamblireeglid- liikide kooseksisteerimise (koosesinemine ja sagedus) piirangud. Traditsiooniliselt peetakse silmas biootilistest interaktsioonidest (eelkõige konkurents) tingitud piirangud, kuid samuti võib vaadelda levimisest või abiootilisest keskkonnast tingitud piiranguid. Biotsönoloogia- teadus biotsönoosidest ja organismide kooseluvormidest. Laiemas tähenduses sama, mis sünökoloogia, kitsamas tähenduses teadus organismide suhtesit looduse...
ellujäämine ja maa kõlblikus(elule) 772. to ensure the sustainable development and viability of the planet kindlustada jätkusuutlik 773. pollution - reostus 774. introduction of substances or energy 775. impairs other legitimate uses of the environment kahjustab teisi seaduslikke 776. involve solid, liquid or gaseous material - hõlmab enda alla fosiilseid, vedelaid ja gaasilisi materjale 777. concept of sustainable development - 778. UN general assembly ÜRO peaassamblee 779. satisfy the needs vajadusi rahuldama 780. habits of consumption 781. life supporting systems elu toetavad süsteemid 782. genetic diversity geneetiline mitmekesisus 783. prove in advance 784. to ban keelustama 785. precautionary means 786. zoning linnaplaneerimine 787. land-use planning maakasutuse planeerimine 788. charges esildis 789. loans laen 790. insurance kindlustus 791. labelling märgistamine 792
functions generally did not include governing. Subsequently, pressed by the necessity of maintaining peace among the native rulers, the Dutch began to govern the territories (now called Indonesia) in order to maintain trade. (3) 2.8 Internal Developments William the Silent had been succeeded in the position known as stadtholder and as military commander by his son Maurice, who in turn was followed by his brother Frederick Henry. These men governed in conjunction with the States-General, an assembly composed of representatives of each of the seven provinces but usually dominated by the largest and wealthiest province, Holland. The stadtholder's power varied, depending on his personal qualities of leadership, and the office eventually became hereditary in the house of Orange. (3) Under Maurice, the republic was divided by a religion-political conflict between two factions within the Reformed (Calvinist) church, over predestination. The Arminian or Remonstrant,
Increasingly however these situations are tending to become fewer as the global forces we have described lead to higher levels of market volatility. How do global supply chains achieve agility? In a sense the very process of globalisation has retarded agility. For example, many companies in 23 their search for lower production costs have moved much of their manufacturing and assembly offshore. The main driver for such moves often being low labour costs. However, in so doing they run the risk of extending their lead-times significantly thus generating the need for more inventory in the pipeline. As a result their agility is reduced. Some organisations have actually sought to reverse this trend by bringing manufacturing back closer to their main markets - Dell Computer being a case in point. Other companies are
Douglas C. Engelbart, of the Stanford Research Institute, demonstrates his system of keyboard, keypad, mouse, and windows at the Joint Computer Conference in San Francisco's Civic Center. He demonstrates use of a word processor, a hypertext system, and remote collaborative work with colleagues. 1969 AT&T Bell Laboratories programmers Kenneth Thompson and Dennis Ritchie developed the UNIX operating system on a spare DEC minicomputer Thompson re-wrote Space Travel game in assembly language for Digital Equipment Corporation's PDP-7 with help from Dennis Ritchie. This experience, combined with his work on the Multics project, led Thompson to start a new operating system for the PDP-7. Advanced Micro Devices Incorporated is founded. Intel's Marcian (Ted) Hoff designs an integrated circuit chip that could receive instructions, and perform simple functions on data. The design becomes the 4004 microprocessor.
47 .47 - Memory: sentence recall, word pairs design Perceptual speed: seeing visual detail quickly Object .49 .49 .69 Reasoning: general rule from few instances assembly (spatial) · PMA tests still used · All correlate positively & show a g factor NB * All tests correlate positively * Some subgroups show especially high correlations: group factors?
These are the flat trawl and the 4-seam semi-balloon. In addition, the 2-seam balloon and western jib designs are used, but not nearly so generally. Sizes of trawls vary from 30 to 90 ft (9 to 27 m) (headline) with the 40 to 60 ft (12 to 18 m) size range most common. Trawl size is designated by the headline length, excluding the leg lines. Synthetic netting primarily nylon, is used almost exclusively, due to its strength, resistance to deterioration and relatively low cost. After assembly, nets are tarred to reduce wear due to abrasion and as a stiffening agent. This is repeated periodically while in use, usually every six to twelve weeks. The use of each design is not restricted to specific geographic areas or species as might be expected, but instead all are used on all grounds. It is a common belief that a flat trawl has inherently a wide spread and a low opening height and that the balloon trawl opens high. This is not necessarily so. Although all types could be
(HDL) or a schematic designed using an Electronic design automation tool. Either of these, when compiled, will generate a net list, that can be mapped to the actual fpga architecture. When done the binary file generated is used to (re)configure the FPGA device. Näited:SRAM, Anti-fuse, EPROM, EEPROM, FLASH FPGA-de projekteerimine Depending on the particular device, the program is either 'burned' in permanently or semi- permanently as part of a board assembly process, or is loaded from an external memory each time the device is powered up. This user programmability gives the user access to complex integrated designs without the high engineering costs associated with application specific integrated circuits. 73 How are FPGA programs created? Individually defining the many switch connections and cell logic functions would be a daunting task
(HDL) or a schematic designed using an Electronic design automation tool. Either of these, when compiled, will generate a net list, that can be mapped to the actual fpga architecture. When done the binary file generated is used to (re)configure the FPGA device. Näited:SRAM, Anti-fuse, EPROM, EEPROM, FLASH FPGA-de projekteerimine Depending on the particular device, the program is either 'burned' in permanently or semi- permanently as part of a board assembly process, or is loaded from an external memory each time the device is powered up. This user programmability gives the user access to complex 71 integrated designs without the high engineering costs associated with application specific integrated circuits. How are FPGA programs created? Individually defining the many switch connections and cell logic functions would be a daunting task
A decision by the Estonian Supreme Council of 16 May 1990, established that the judicial system of the Republic of Estonia was to be founded on the will of the Estonian people and universally recognised norms of international law. During the days of the August 1991 coup attempt the Estonian Supreme Council confirmed once more the national sovereignty of the Republic of Estonia and requested that diplomatic relations be restored on the basis of continuity. At the same time, a Constitutional Assembly was formed for the task of drawing up a constitution. The Constitution, which was adopted by popular referendum on 28 June 1992, establishes the rule of law and judicial power as the basic ideas. It determines the role of the courts and their position in the general system of government. Modern legal theories, the examples of other countries, Estonia's own experiences from ancient times and the first period of independence, and current conditions and possibilities are taken into account.
interrupted by the global economic crisis in 20082009. The fuel and petrochemical sector suffered the most from the price shock. Sales problems resulted in frequent work stoppages at many enterprises, especially in the automotive industry and other machine-building sectors. The crisis of 2011 also had a considerable impact on certain industries. This is particularly true of industries that substantially depend on imported materials and assembly parts. In this respect, the reduction of the so-called "import dependence" of the economy became one of the main lines of state industrial policy. This is expressed, for instance, in an effort to 54 maximally localize certain production units and to stimulate the production of assembly parts or develop Belarusian analogues to them. However, the steps that have been taken are
executed without human intervention on the shop floor. Software performing the task of descriptive geometry translates three-dimensional numerically-defined models into two- dimensional fabrication data that accurately cuts components, pre-drills holes for fixings and service penetrations. While producing more sophisticated steelwork, the skilled labor content is being reduced overall and focused increasingly upon the final assembly of CNC milled components (LeCuyer, 2003). The 3D steel detailing model is becoming a deliverable to fabricators and erectors. Not only is it easier for the detailer to visualize the complex geometry and connections of today’s projects via a 3D model, it is also beneficial for shop production, project managers, and field superintendents. With BIM, 2D drawings are just one portion of the deliverable. CNC-driven machinery is becoming more powerful and affordable, and
a. Selle eesmärk oli analüüsida poliitikaid ja anda soovitusi otsusetegijatele rohelistesse sektoritesse investeerimiseks ja suure keskkonnamõjuga sektorite rohelisemaks muutmiseks. Rohemajandus ja jätkusuutlik valitsemine olid ka Rio de Janeiros 20.–22. juunil 2012 toimunud ÜRO säästva arengu konverentsi (Rio+20) 4 peateemad. Konverentsil võeti vastu ühisdeklaratsioon tulevikust, mida me tahame saavutada: „The Future We Want“ (United Nations General Assembly 2012), mis paljude ekspertide hinnangul jäi aga loodetust üldsõnalisemaks ja konkreetseid kohustusi koos ajakavaga kokku ei lepitud. Üksmeel saavutati muuhulgas näiteks rahvusvahelise keskkonnaalase valitsemise (ÜRO keskkonnaprogramm ja säästva arengu komisjon) reformimise ning säästva tarbimise ja tootmise raamprogrammide loomise vajalikkuses Majanduskoostöö ja Arengu Organisatsiooni (OECD) rohelise ehk keskkonnahoidliku majanduskasvu
KOSE GÜMNAASIUM Uurimistöö Tsiilist Küsimustiku alusel I Üldandmed Ülevaade Tsiilist Geograafilised koordinadid: 30 00 S, 71 00 W Tsiili on pikim riik maailmas (põhjast-lõunasse), ta ulatub pikki Vaikset Ookeani üle 4200. kilomeetri. Tsiili kogupindala on 756950 ruutkilomeetrit, maismaad 748800 ja territooriumi merel 8150 ruutkilomeetrit. Tsiilile kuuluvad ka Lihavõttesaar, Sala y Gòmeze, San Fèlixi, San Ambrosio ja Juan Fernandeze saared Vaikses ookeanis.Samas on tema maksimaalne laius vaid 430 kilomeetrit. Tsiili naaberriikideks on Peruu (riigipiir 171 km), Boliivia (riigipiir 860 km) ja Argentiina (riigipiir 5308 km). Suhteliselt väikeses Keskorus, kus asub ka riigi pealinn Santiago, seal elab suur osa kogu rahvastikust,1993. aasta andmetel 4,63 miljonit. Riigikeeleks on seal hispaania keel ja rahaühikuks Tsiili peeso (CLP). Tsiili hümniks loetakse "Himno Nacional", seaduslik kogu asub Valparaísos. Suurimad linnad:...
government committees or legal experts. In such a constitutional system, all these elements may be (or may not be) recognized by courts, legislators and the bureaucracy as binding upon government and limiting its powers. Such a framework is sometimes imprecisely called an "unwritten constitution"; however, all the elements of an uncodified constitution are typically written down in a variety of official documents, though not codified in a single document. The legislature is a deliberative assembly with the authority to make laws for a political entity such as a country or city. Legislatures form important parts of most governments; in the separation of powers model, they are often contrasted with the executive and judicial branches of government. Laws enacted by legislatures are known as legislation. Legislatures observe and steer governing actions and usually have exclusive authority to amend the budget or budgets involved in the process.
a. Selle eesmärk oli analüüsida poliitikaid ja anda soovitusi otsusetegijatele rohelistesse sektoritesse investeerimiseks ja suure keskkonnamõjuga sektorite rohelisemaks muutmiseks. Rohemajandus ja jätkusuutlik valitsemine olid ka Rio de Janeiros 20.–22. juunil 2012 toimunud ÜRO säästva arengu konverentsi (Rio+20) 4 peateemad. Konverentsil võeti vastu ühisdeklaratsioon tulevikust, mida me tahame saavutada: „The Future We Want“ (United Nations General Assembly 2012), mis paljude ekspertide hinnangul jäi aga loodetust üldsõnalisemaks ja konkreetseid kohustusi koos ajakavaga kokku ei lepitud. Üksmeel saavutati muuhulgas näiteks rahvusvahelise keskkonnaalase valitsemise (ÜRO keskkonnaprogramm ja säästva arengu komisjon) reformimise ning säästva tarbimise ja tootmise raamprogrammide loomise vajalikkuses Majanduskoostöö ja Arengu Organisatsiooni (OECD) rohelise ehk keskkonnahoidliku majanduskasvu