C++. Earlier version of Java were very slow. Marner presents figures showing JDK 1.0 to be 20 to 40 times slower than C++ [Marner 2002]. Fortunately, successive versions have brought Java much closer to C++: J2SE 1.4 is typically 1.2-1.5 times slower. These numbers depend greatly on the coding style used Java coded in a straightforward, textbook-style may still be 2.5 to 4 times slower. This shows that Java programmers must be good programmers in order to utilise Java efficiently (but that's true of any language). Jack Shirazi's Java Performance Tuning website (http://www.javaperformancetuning.com/) is a good source for performance tips, and links to tools and other resources. Recent numerical benchmarks on Linuxes found that compiled C++ and Fortran were at least twice as fast as Java byte code. But the performance was very dependent on the chosen JVM; IBM's implementation exceeded the performance of C++ code compiled with gcc [Ladd 2003].
1. Algoritm. Algoritmi keerukus. Ajalise keerukuse asümptootiline hinnang. Erinevad keerukusklassid: kirjeldus, näited. 1.1 Algoritm • Mingi meetod probleemi lahendamiseks, mida saab realiseerida arvutiprogrogrammi abil. • Algoritm on õige, kui kõigi sisendite korral, mis vastavalt algoritmi kirjeldusele on lubatud, lõpetab ta töö ja annab tulemuse, mis rahuldab ülesande tingimusi. Öeldakse, et algoritm lahendab arvutusülesande. • Selline programm, mis annab probleemile õige vastuse piiratud aja jooksul. • Kindlalt piiritletud sisendi korral vastab ta järgmistele kriteeriumitele: o lõpetab töö piiratud aja jooksul; o kasutab piiratud hulka mälu; o annab probleemile õige vastuse. • Parameetrid, mille järgi hinnata algoritmide headust: o vastava mälu hulk; o töötamise kiirus ehk vajatava aja hulk.
To obtain a finite number of reachable markings(– limit tokens to simultaneously reside in places A, B, C, D – add extra place of color set UNIT – the initial marking Limit is the multiset 3‘() ) Simulation can only be used to explore a finite number of executions of the system under consideration. State-space construction continues until no unprocessed nodes remain. Node processing one by one, in some abritrary order. If the state space is finite, the construction will terminate when we have processed all reachable markings. Create a state-space report (– answers initial behavioural properties– early-design phase errors evident in state-space reports – user can draw interactively selected parts to inspect individual states & events) 15.SSC graph The SCC graph is used by the CPN state space tool to check behavioral properties of a model.
bit & stop bit. bit synchronization uses start bit & stop bit for each byte. Internally , nodes store, ability to hold separate sessions with different stations(on multipoint line) 2. the sending process. process, & transfer data in parallel Transmission control circuit - interface between node & link: · PISO Secondary Station - can only communicate with the In order to specify that this is a SNAP frame, the DSAP/SSAP shift register: parallel->serial conv. for transmission · SIPO shift register: serial->parallel conv. for primary station. Secondary stations only talk to each other via a Primary station: is set to AA hex. receiveing · bit, character, frame synchronization · set data rate, data format · error control: receive command frames from Primary, transmit response frames to Primary. 3
Ülekandekiirust reguleeritakse congestion window (saateakna) suurusega (kontrollib korraga maksimaalselt saadetavate kinnitamata segmentide hulka). Läbilase = w*MSS / RTT [B/s] w – ühe RTT jooksul saadetud segmentide arv MSS – maksimaalne segmendi suurus RTT – Round Trip Time Üldine strateegia: suurendada w väärtust, kuni esinevad kaod, seejärel vähendada väärtust tagasi 1-ni ja hakata vaikselt jälle suurendama, pidevalt kadusid kontrollides. Saadet alustatakse SlowStart algoritmi kasutades: alguses CongWin = 1, iga kinnitatud segmendi kohta CongWin++, kuni tekib kadu või CongWin jõuab üleminekuläveni. Jõudes üleminekuläveni, toimub CongWin++ iga w vastuvõetud kinnituse kohta, kuni tekib kadu. Seejärel vähendatakse üleminekuläve CongWin/2 –ni, CongWin = 1 ning alustatakse SlowStart’iga uuesti. 28. UDP UDP – User Datagram Protocol 18
R Sbjct 4331100 VTRSVRSRAFRKWWSTSG*K**RSIALRPPVFRSSLVPRLKMDPLTRGSYV*NCCLQIWR 4330921 Query 86 YQRS*F*RHEPQR*YCAF*CQRAFSCPL 3 YQRS*F*RHEPQR*YCAF*CQRAFSCPL Sbjct 4330920 YQRS*F*RHEPQR*YCAF*CQRAFSCPL 4330837 Sarnaseid järjestusi leiti veel näiteks organismides: Shigella Klebsiella Enterobacter Yersinia pseudotuberculosis b. Analüüsida tulemusi mis liik, mis geenid ja valgud. Milline algoritm oli kõige tundlikum. Esimene meetod andis esimese tulemusena E. Coli aspartokinaasi III, teine meetod pakkus hohkem erinevaid variante, esimene valk oli E. Coli kas aspartokinase III või glucosephosphate isomerase. Ccgagaggacaactaaacgcacgttggcatcagaaagcacaatatcagcgctgcggttcatggcgtcaaaatcagctacgctggtac cgccaaatttggagacaacaatttcagacataactacctcgtgtcaggggatccattttcagccttggcacaagggaagagcggaagac gggtgggcgcagagcgatacttcgctactattttcacccagaagtgctccaccacttgcgaaacgcccgactgcgaacgcttctggtga
supplied. Doing so may result in electric shock. ! WARNING Do not attempt to disassemble, repair, or modify any Units. Any attempt to do so may result in malfunction, fire, or electric shock. ! WARNING Provide safety measures in external circuits (i.e., not in the Programmable Controller), including the following items, in order to ensure safety in the system if an abnormality occurs due to malfunction of the PC or another external factor affecting the PC operation. Not doing so may result in serious accidents. • Emergency stop circuits, interlock circuits, limit circuits, and similar safety measures must be provided in external control circuits.
cp specific heat, J·kg-1·K-1 T temperature difference between the outlet and inlet temperatures of the fluid inside the coil, K The unsteady state is a little more difficult to understand, because the temperatures are changing with time. The unsteady heat transfer is important because of the vast amount of heating and cooling problems occurring industrially. In metallurgical processes it is needed to predict the heating or cooling rates of various geometries of metals in order to know how 3 much time it will take for them to reach a certain temperature. In the paper industry logs are immersed in steam baths before processing. In many processes materials are immersed in liquids of higher or lower temperatures resulting in unsteady heat transfer. (Geankoplis, 1993) Consider a system formed by a tank filled with a mass of fluid inside which a helical coil is immersed
encouragement and utilising the latter's recently completed Programmers' Handbook for the Ferranti computer). By the summer of 1952 this program could, Strachey reported, "play a complete game of Draughts at a reasonable speed". Prinz's chess program, also written for the Ferranti Mark I, first ran in November 1951. It was for solving simple problems of the mate-in-two variety. The program would examine every possible move until a solution was found. On average several thousand moves had to be examined in the course of solving a problem, and the program was considerably slower than a human player. Turing started to program his Turochamp chess-player on the Ferranti Mark I but never completed the task. Unlike Prinz's program, the Turochamp could play a complete game and operated not by exhaustive search but under the guidance of rule-of-thumb principles devised by Turing. Early AI programs: checkers (in USA) The first AI program to run in the U.S
Pilt veebiteenuste abil integreerimisest Erinevad platvormid ja programmeerimiskeeled Erinevad kasutajaliidesed ühel kesksüsteemil Erinevad organisatsioonid Varjatud realisatsioon Kliendi ja teenusepakkuja sõltumatu arendus Veebiteenuste eelised.. Veebiteenuste puudused… Erinevate platvormide rakenduste Suurem keerukus koostöö võimaldamine Väiksem jõudlus Teksti põhised ja avatud standardid on ... arendajale arusaadavad Annavad võimaluse erinevate ettevõtete erinevas kohas asuvaid rakendusi ja teenuseid integreerida üheks uueks teenuseks Veebiteenuste taaskasutamise võimalus
(ii) transcription / transcribed; R transcriptase 1 (b) (i) J anticodon; R anticodons K transfer RNA / tRNA; L ribosome / rRNA; M codon; R codons 4 (ii) 1 DNA triplet / codon / M / mRNA triplet, codes for specific amino acid; 2 order of, triplets / bases, determines the order of amino acids; 3 tRNA / K, has, corresponding / complementary, triplet / anticodon; 4 (tRNA / K) attached to specific amino acid; 5 activation of amino acid; 6 2 (tRNA) binding sites on the ribosome; 7 codon and anticodon bind; A match 8 A to U and C to G;
A proxy, in its most general form, is a class functioning as an interface to something else. The proxy could interface to anything: a network connection, a large object in memory, a file, or some other resource that is expensive or impossible to duplicate. A well-known example of the proxy pattern is a reference counting pointer object. In situations where multiple copies of a complex object must exist the proxy pattern can be adapted to incorporate the flyweight pattern in order to reduce the application's memory footprint. Typically one instance of the complex object is created, and multiple proxy objects are created, all of which contain a reference to the single original complex object. Any operations performed on the proxies are forwarded to the original object. Once all instances of the proxy are out of scope, the complex object's memory may be de allocated. 6. Antipatterns
Sissejuhatus infotehnoloogiasse 1. Loeng Algoritm on täpne samm-sammuline, kuid mitte tingimata formaalne juhend millegi tegemiseks. Näited: a. Toiduretsept. b. Juhend ruutvõrrandi lahendamiseks Algoritmiline probleem - probleem, mille lahenduse saab kirja panna täidetavate juhendite loeteluna. Programm on formaalses, üheselt mõistetavas keeles kirja pandud algoritm. Arvutid suudavad täita ainult programme. Analoogsüsteem andmeid salvestatakse (peegeldatakse) proportsionaalselt Näit: termomeeter, vinüülplaat, foto Digitaalsüsteem (pidevad) andmed lõhutakse üksikuteks tükkideks, mis salvestatakse eraldi Näit: CD, arvutiprogramm, kiri tähtede ja bittidena Ühelt teisele: digitaliseerimine The three major comparisons of computers are:
A... AA Auto Answer AAA Authentication, Authorization and Accounting AAB All-to-All Broadcast AAC Advanced Audio Coding AACS Advanced Access Control System AAL Asynchronous Transfer Mode Adaption Layer AAM Automatic Acoustic Management AAP Applications Access Point [DEC] AARP AppleTalk Address Resolution Protocol AAS All-to-All Scatter AASP ASCII Asynchronous Support Package AAT Average Access Time AATP Authorized Academic Training Program [Microsoft] .ABA Address Book Archive (file name extension) [Palm] ABAP Advanced Business Application Programming [SAP] ABC * Atanasoff-Berry Computer (First digital calculating machine that used vacuum tubes) ABEND Abnormal End ABI Application Binary Interface ABIOS Advanced BIOS ABIST Automatic Built-In Self-Test [IBM] ABLE Adaptive Battery Life Extender + Agent Building and Learning Environment [IBM]
Thoraco-dorsal Fascia The Chop and Lift Full and Half-Kneeling Ideal Placement on One Line Tricep Rope Attachment Single-Leg Flexibility Assessment Down-Left Chop Ideal Placement Down-Left Chop Ideal Placement Turkish Get-Up Start and Finish of Two-Arm Single-Leg Deadlift RUNNING FASTER AND FASTER Hip Flexors Stretch Reverse Lunge Demonstration Untrained and Trained Start Positions Reverse Hyper(extension) on a Bench and Swiss Ball Enzyme Activity Graph Super Quad Stretch Pelvic Symmetry and Glute Flexibility Stretches Repositioning the Pelvis Pre-Workout Glute Activation Running by the Numbers Video Snapshots Diagram of Energetic Systems Taper Schedule 12-Weeks to 50k Schedules GETTING STRONGER How to Perform the Conventional Deadlift Brench-Press Plyometrics The Torture Twist The Sumo Deadlift The Sharapova Sit-Up: Janda Bench Pressing 854 Pounds: Set up Bench Pressing 854 Pounds: Technique FROM SWIMMING TO SWINGING
- it implies that - we may infer that - etc. Premise(s) indicators Swans must have wings, since they are birds and birds do have wings. The word “since” indicates the premises which are claimed to support the conclusion. Other premise(s) indicators include: - because - for - given that - as - for the reason that - may be inferred from - follows from - etc. Two remarks on indicators: 1. The occurence of an indicator does not suffice. We need to find also an inferential relationship. a. Since yesterday, it did not stop raining (temporal meaning) b. Since it is raining, I will take my umbrella (logical meaning) 2. Sometimes, there are no indicators. It is then necessary to inquire the implicit inferential relationshio between the statements in order to identify what statement follows from the other(s).
my body in various ways, and the really good ones were stimulating more than one organ. A n effective story grabs your gut, tightens your throat, makes your heart race and your lungs pump, brings tears to your eyes or an explosion of laughter to your lips. If I wasn't getting some k i n d of physiological reaction from a story, I knew it was only affecting me on an intellectual level and therefore it would probably leave audiences cold. You will find my thoughts about this in a new chapter on the wisdom of the body. W h e n my job at Fox 2 0 0 0 came to an end, as all good things must do, I wanted to write and produce some projects of my own. I soon found myself writing the screenplay for an animated feature, the result of a lecture trip to Munich. I was approached by producer Eberhard Junkersdorf to write the script for his version of the merry adventures of T i l l Eulenspiegel, Europe's favorite medieval clown. I knew
People use idioms to make their language richer and more colorful and to convey subtle shades of meaning or intention or to make a sentence more precise and clean. Runs in the family VS It is common throughout the line of our extended family over a number of generation. Examples: pull smb leg, kick the bucket, Jump the gun - would mean to be doing something early 46. Syntactic freezes (irreversible binomials, trinomials) Irreversible idiom – a multi-word expression whose order cannot be hanged. Also known as freezes Binomial idiom= a two-part irreversible idiom bits and pieces, through thick and thin, spick and span, here and there, safe and sound Trinomial idiom = a three part irrereversible idiom here, there, and everywhere Semantic principles of ordering – me first principle Phonological ordering principles (myopia or the short-long 1) Proximal deictics precede distal deictics this andthat, principle) (Ross)
temperature. All the other parts in the system, including the sensors them- selves, have similar variations. While these will be addressed in more detail in Chapter 9, “High-Precision Applications,” the important thing from a system point of view is this: how will the required accuracy be achieved? For example, say we’re still trying to measure that 0-to-100°C temperature range. Measurement with 1°C accuracy may be achievable without adjust- ments. However, you might find that the .1°C figure requires some kind of calibration because you can’t get a temperature sensor in your price range with that accuracy. You may have to include an adjustment in the design to compensate for this variation. The need for a calibration step implies other things. Will the part of the system with the temperature sensor be part of the board that contains the compensation? If not, how do you keep the two parts together once calibra- tion is performed
genome has tens to thousands of rDNA copies, containing genes substitutions may be absent, a different strategy is needed to for 18S, 5.8S, and 28S rRNAs. Between these genes, on either side adequately analyse the heterogeneity of the gene pool. We hereby of the 5.8S rRNA gene, the internal transcribed sequences (ITS), describe a method that also allows for the quantification of the ITS1 and ITS2, are located [1]. In order to preserve the amounts of different alleles containing heterogeneities caused by functionality of multicopy genes, concerted evolution is at play. indel events. We use the ITS sequences of the freshwater sponge However, homogenisation of all the gene variants is not always Ephydatia fluviatilis as an example, and describe intra-individual complete [2]
You must concentrate on details, such as names, dates, and the main idea of the selection that you hear. Do not read the choices as you listen to the talk. Listen care-fully and try to remember what you hear. SECTION 2: STRUCTURE AND WRITTEN EXPRESSION This section contains two types of questions, both designed to test your ability to recognize correct style and grammar in written English. The sentences are academic; ones that you typically find in college level texts, journals, and encyclopedias. The sentence topics include the social sciences, physical and life sciences, and the humanities. Structure The structure questions test your ability to recognize correct structure and word order. These questions consist of a sentence with one or more words missing. You must make the choice that best completes the sentence. Here is an example of this type of question. YOU WILL SEE:
6 drop me off A. So there you are ... problem solved! 7 to lay off Rosie Yeah, these are good 8 turned up intentions, but not if we end up poisoning people in the long run. I 1F Discussion page 9 don't know, I just find the whole thing unnatural. I don't think we have a right 1 1 laboratory 5 crops to `play God' in this way. 2 controversy 6 harmful Leo I see what you mean. But to be 3 discredited 7 term honest with you, people have been 4 campaign 8 crisis crossing breeds for hundreds of years.
project deadline. From this analysis, it was discovered that one of the reasons why there has been an increase in the design and construction of buildings with highly complicated geometry is the advent of 3D and BIM tools. The main themes that emerged were: • 3D and BIM increase collaboration between different project participants; • A reduction in construction time is evident only when the building models are openly shared; • Intelligent models help to find clashes and reduce re-work; • Models increase accuracy during fabrication and construction; • Shop-drawing review is sped up; • Steel design takes place in a more concurrent fashion; • 3D illustrations help to explain erection sequencing; • Building models provide rigging information for erection crews. The results of this thesis illustrate the benefit that 3D and BIM offer for complex steel construction projects and demonstrate an overall trend in the construction industry
· EXTRAVERSION: Bold, extraverted, -introverted, -quiet, -reserved, - N E O A C shy, talkative, -timid, -untalkative, -withdrawn Anxiety Warmth Fantasy Trust Competence Angry Gregarious Aesthetics Straight- Order · EMOTIONAL STABILITY: anxious, emotional, envious, fearful, highly hostility forward strung, irritable, jealous, moody, self-pitying, touchy Depression Assertive Feelings Altruism Dutifulness · CONSCIENTIOUSNESS:-careless, -disorganised, efficient, -inefficient,
the muscle and the vascular system. such as aiding in movement of blood and The second largest component of muscle lymph and also in maintaining body tempera- is protein (U.S. Department of Agriculture ture. All of these functions are dependent 2008). Protein makes up an average of 18.5% on cellular metabolism and the ability of the of the weight of the muscle, though that cell to maintain energy supplies. Few cells figure can range from 16 to 22%. Proteins are required to generate as much force and serve myriad functions and are the primary undergo as dramatic shifts in rate of metabo-
form. A sample cipher alphabet might be: plaintext letters abcdefghijklm cipher letters LBQACSRDTOFVM plaintext letters nopqrstuvwxyz cipher letters HWIJXGKYUNZEP This graphically indicates that the letters of the plaintext are to be replaced by the cipher letters beneath them, and vice versa. Thus, enemy would become CHCME, and swc would reduce to foe. A set of such correspondences is still called a "cipher alphabet" if the plaintext letters are in mixed order, or even if they are missing, because cipher letters always imply plaintext letters. Sometimes such an alphabet will provide multiple substitutes for a letter. Thus plaintext e, for example, instead of always being replaced by, say, 16, will be replaced by any one of the figures 16, 74, 35, 21. These alternates are called homophones. Sometimes a cipher alphabet will include symbols that mean nothing and are intended to confuse interceptors; these are called nulls.
iteraator. Iteraatori põhioperatsioonid on: boolean hasNext() Returns true if the iteration has more elements. Object next() Returns the next element in the iteration. Comparable-liides annab võimaluse objekte võrrelda (klassid String, Integer, Double, .... realiseerivad selle liidese). Kuulub paketti java.lang: public int compareTo(Object o) Compares this object with the specified object o for order. Returns a negative integer, zero, or a positive integer as this object is less than, equal to, or greater than the specified object o. Throws: ClassCastException - if the specified object's type prevents it from being compared to this Object. Klass Collections pakub kiireid algoritme vajalike tööde tegemiseks kogumitega. Sarnane klass tööks massiividega on Arrays (mõlemad paketist java.util).
moves made by the various theorists and their opponents and objectors. In particular, I doubt that any of the objections to any of the theories is fatal; champions of theories are remarkably good at avoiding or refuting objec- tions. The real theorizing begins where this book leaves off. x Preface I have used some notation of formal logic, specifically the predicate calcu- lus, for those who are familiar with it and will find points made clearer by it. But in each case I have also explained the meaning in English. Many of the writings to be discussed in this book can be found in the following anthologies: T. Olshewsky (ed.), Problems in the Philosophy of Language (Austin, TX: Holt, Rinehart and Winston, 1969); J. F. Rosenberg and C. Travis (eds.) Readings in the Philosophy of Language (Englewood Cliffs, NJ: Prentice-Hall, 1971); D. Davidson and G. Harman (eds.), The
initial positions in finite verb phrases (e.g. She [is reading]VP a book now). Finite verbs Present Simple: I type I speak Present Continuous: I am typing I am speaking Past Simple: I typed I spoke Present Perfect: I have typed I have spoken Non-finite verbs Present Participle: Typing speed Speaking engagement Perfect Participle: Having typed Having spoken Past Participle: Typed letters Spoken commentary Gerund: Typing can be difficult. Do you find speaking stressful? Infinitive: To type is a real skill. They want you to speak. Be, do, have main verbs or auxiliary verbs: A feature [±AUX] distinguishes main verbs from auxiliary verbs There is no random usage of either [+AUX] or [AUX] element of this syntactic class in English dialects but their properties tend to cluster in the sense of exhibiting all or none of the properties. BE HAVE DO
Linguistic stylistics--views linguistic facts from the point of view of their ability to convey additional shades of meaning. Any act of speech passes on 2 types of information: · The content as such · Additional inf. which finds expression in all kinds of extra shades of meaning that are attached to the main content The form of speech may vary depending on the speaker, the listener and the circumstances they both find themselves (to begin-to commence--to get going) Stylistics studies everything that makes the text or the utterance special. It cuts across all the basic linguistic sciences: · Phonetics--silent, sleepy streets · Morphology--speak, spoke, spake · Syntax--he came in-in came he · Lexicology--finish-terminate (synonymic pairs) A survey of the development of stylistic studies: It is a relatively new branch in philology; yet, its roots go back as far as ancient Greek
From the stylistic point of view they are 2 different models of expression because they carry different stylistic overtones. "Spake" is archaic and therefore is used in elevated style or for the irony in everyday speech, while "spoke" is just the ordinary way of expressing. In syntax the sentence structure may differ and the stylistic effect may be different: "He came in" (neutral) "In he came" (more dynamic). Here we observe inversion different word order it is more powerful. In lexicology we find many examples of synonymic pairs in which the borrowed word carries bookish term and the native word is neutral (e.g. begin - commence, understand comprehend, think cogitate, etc.). "He came home drunk" no extra shades of meaning. "He returned to his residence in a state of intoxication" has extra shade of meaning (irony). "He died poor" no extra shades of meaning.
ing attention to them by shifting their location to a more central display area; no luck. She even told her sales staff to "push" the items hard-again without success. Finally, the night before leaving on an out-of-town buying trip, she scribbled an exasperated note to her head saleswoman, "Everything in this display case, price x '/2 ," hoping just to be rid of the offending pieces, even if at a loss. When she re- turned a few days later, she was not surprised to find that every article had been sold. She was shocked, though, to discover that, because the employee had read the '''/2'' in her scrawled message as a "2," the entire allotment had sold at twice the original price! That's when she called me. I thought I knew what had happened but told her that, if I were to explain things properly, she would have to listen to a story of mine. Actually, it isn't my story; it's about mother turkeys, and it belongs to the relatively
The methods of structural linguistics were most popular in 70s and 80s. Present day stylistic studies have gradually taken a more systematic course. Computer assisted stylistic analysis seems quite promising (e.g. the study of cases of disputed authorship). Although still somewhat chaotic and unorganized stylistics is a vigorous young science with wide potential and prospects. 2. INHERENT CONNOTATION Meaning of a word has: a denotation (meaning proper, we find it in dictionaries) and a connotation (an additional shade of meaning). Connotation may be a permanent part of word meaning it is then called inherent connotation. Connotation is ever present when the word is used. Adherent connotation is the shade of meaning the word requires in a particular context only. Outside this context this shade of meaning is not present. INHERENT CONNOTATION (IC) 1. IC may be secured by the very object, quality or notion that word denotes
annaabi.ee 
Sisene Facebook'ga
Sisene Google'ga
Sisene LinkedIn'ga
