My favorite tv program My favorite tv program is Gossip Girl . Gossip girl is based on the book series written by Cecily von Ziegesar. The series comprises the lives of socialite teenagers who live in New York City's Upper East Side. The serial have 8 main characters Serena van der Woodsen, Blair Waldorf, Chuck Bass, Nate Archibald, Jenny Humphrey, Dan Humphrey, Lily van der Woodsen and Rufus Humphrey. Serena is daughter of Lily, Rufus is Jenny's and Dan's father, Nate and Blair is a couple in the first season. They all have very scandalous lives. Every day ends with a mess.
Learning Foreign Language through an Interactive Multimedia Program: An Experimental Study on the Effects of the Relevance Component of the ARCS Model M. - M. CHANG ja J. D. LEHMAN Chang M.-M., Lehman, J. D. (2002). Learning Foreign Language through an Interactive Multimedia Program: An Experimental Study on the Effects of the Relevance Component of the ARCS Model. CALICO Journal. 20 (1), 81 – 89. Töös uuriti sisemise motivatsiooni (SM) ja eluliselt näitlikustatud tehnoloogiliste õppematerjalide (CBIM) kasutamise mõju inglise keelt võõrkeelena õppivate (EFL) õpilaste tulemustele. Uuringus osalesid Taiwani ülikooli õpilased vanuses 19 – 22 eluaastat, kes kõik olid inglise keelt varasemalt õppinud vähemalt 6 aastat. Õpilaste eriala ülikoolis ei olnud oluline. Lõplikes analüüsides kasutati 313 õpilase tulemusi. Uuringus püstitati 4 hüpotees: Kas õpilased, ke...
Review Top Gear is an entertaining TV program for car enthusiasts. Usually episodes are made in United Kingdom, but some are made in Europe and America. Presenters are Jeremy Clarkson, Richard Hammond who called "Hamster" and James May who called "Captain Slow". Top Gear has done 15 seasons and now 16 season is coming completely on 16th March. In program they test cars and they make one quick lap with that car. Their racing driver is called The Stig. They make some challanges with old and cheap cars and they show which car is best in that category. They have guests in show. Their guest drive fast lap with Kia Cee´d which is normal price car and not very fast. Then they take the lap time and but it on the board. They use the wall, which called "Cool Wall". There is many cars which are cools, un cools, seriously un cools or sub zeros, like they think. Every episode they change car positions. The latest episode was very funny. UK Top Ge...
Application Dear Sir or Madam, I am writing in reply to your advertisement I saw in a magazine and I would like to take part in your program but I would need some extra information. The first question that emerged when I read the title of the advertisement was is there any age limit that I need to fit in? It would be really nice of you, if you could tell me, where I need to publish my work and if it is acceptable if I send you my poetry. I would be really pleased, if you could answer my most important question. Do you have any official e-mail addresses, where I could send my manuscript and is there any dedline? I look forward to hearing from you. Yours sincerely, Tiit Tamm
Eriala: Informaatika Inglise keel Referaat «Trojan horse » Lektor S.Remmelg Üliõpilane A.Parts Rühm RDIR23 Kood 103373 Introduction Trojan (also - troyamn, troyamnets, troyamnsky horse Troma) - a program used by an attacker to gather information, its destruction or modification of, computer malfunction or use of its resources in the wrong purposes. According to the principle of distribution and of the Trojans is not a virus because it does not spread by self-reproduction. This Trojan is run by the user manually or automatically - the program or part of the operating system running on a victim computer (as a module or utility). For this program file (the name, icon of the program) is called the official name of masquerading as another program (such as the installation of another program), another file type, or just give us attra...
Motivation Letter : Dear Summer School’s Committee, Referring to the announcement on billboard and online information, I want to apply to be chief committee and buddy position on ITFSS committee. Online information is one of the reason for me to apply the position on the ITFSS committee. I have choosen to apply for ITFSS commmitte, because two years ago, I was became participant on Summer School Program. According to my experience, I have got many friends, learn many things new, and also this is an exciting program. At this moment, I want to join summer school program committee in hope to get new experience again and give something fresh and new to this program. I have choosen chief committee on this program because the first reason is, I have many experience in many committee and also skills how to manage a team, and lead them wisely. Second reasons, I have good confiden...
Maailma Toiduprogramm (World Food Program) Mis on Maailma Toiduprogramm? · See on ÜRO toiduabiharu · Maailma suurim humanitaar organisatsioon · MTP pakub toiduabi keskmiselt 90 miljonile inimestele aastas · MTP asutati 1961. aastal · Veebileht www.wfp.org MTP sümbol MTP eesmärk · Nälja ja alatoitumise kaotamine ning toiduabi vajaduse vähendamine MTP strateegiad põhinevad sellest, et toiduabi... · Päästab põgenike · Parandab kriisisituatsioonis inimeste toitumist · Edendab vaeste inimeste ja kogukondade iseseisvat toimutulekut Kasutatud materialid · www.wtp.org · https://www.google.com/search?q=world+fo od+program&source=lnms&tbm=isch&sa=X&ei= TH-LUojVNsGL4ATZz4GICA&sqi=2&ved=0CAcQ_A UoAQ&biw=1366&bih=623#facrc=_&imgdii=_&i mgrc=ZKpD1zMs45r2yM%3A%3B3lWZdehijRAjUM 3Bhttp%253A%252F%252Fwww.ghanacurrentjob s.com%252Fwp-content%252Fuploads%252F201 2%252F05%252Fwfp-world-food-program-job- vacancy.jpg%...
Tallinna Tehnikaülikool Majandusteduskond Mikk Murel Youtube Referaat Juhendaja:Teele Heller Tallinn 2013 1 Table of Contents Sissejuhatus..........................................................................................................................................3 Firma ajalugu........................................................................................................................................4 Video tehnoloogia.................................................................................................................................5 Levik.....................................................................................................................................................6 Muusika industrioon..............................................................................................................
Sissejuhatus infotehnoloogiasse 1. Loeng Algoritm on täpne samm-sammuline, kuid mitte tingimata formaalne juhend millegi tegemiseks. Näited: a. Toiduretsept. b. Juhend ruutvõrrandi lahendamiseks Algoritmiline probleem - probleem, mille lahenduse saab kirja panna täidetavate juhendite loeteluna. Programm on formaalses, üheselt mõistetavas keeles kirja pandud algoritm. Arvutid suudavad täita ainult programme. Analoogsüsteem andmeid salvestatakse (peegeldatakse) proportsionaalselt Näit: termomeeter, vinüülplaat, foto Digitaalsüsteem (pidevad) andmed lõhutakse üksikuteks tükkideks, mis salvestatakse eraldi Näit: CD, arvutiprogramm, kiri tähtede ja bittidena Ühelt teisele: digitaliseerimine The three major comparisons of computers are: Electronic computers versus Mechanical computers...
Stability control systems are offered under the following names: * Acura: Vehicle Stability Assist (VSA) * Alfa Romeo: Vehicle Dynamic Control (VDC) * Audi: ESP - Electronic Stabilization Program * Buick: StabiliTrak * BMW: Dynamic Stability Control (DSC), including Dynamic Traction Control * Cadillac: All-Speed Traction Control & StabiliTrak * Chevrolet: StabiliTrak (except Corvette - Active Handling) * Chrysler: Electronic Stability Program (ESP) * Dodge: Electronic Stability Program (ESP) * DaimlerChrysler: Electronic Stability Program (ESP) * Fiat: Electronic Stability Program (ESP) and Vehicle Dynamic Control (VDC) * Ferrari: Controllo Stabilita (CST) * Ford: AdvanceTrac and Interactive Vehicle Dynamics (IVD) * GM: StabiliTrak * Hyundai: Electronic Stability Program * Honda: Electronic Stability Control (ESC) and Vehicle Stability Assist (VSA) and Electronic Stability Program (ESP) * Holden: Electronic Stability Program (ESP) * In...
Cat. No. W317-E1-11 SYSMAC CPM1A Programmable Controllers OPERATION MANUAL CPM1A Programmable Controllers Operation Manual Revised October 2007 iv Notice: OMRON products are manufactured for use according to proper procedures by a qualified operator and only for the purposes described in this manual. The following conventions are used to indicate and classify precautions in this manual. Always heed the information provided with them. Failure to heed precautions can result in injury to people or dam- age to property. ! DANGER Indicates an imminently hazardous situation which, if not avoided, will result in death or serious injury. Additionally, there may be severe property damage. ! WARNING Indicates a potentially hazardous situation which, if not avoided, could re...
SHIP DISPOSAL ESTONIAN MARITIME ACADEMY SCHOOL ERIK ALVISTE 2009 SHIP DISPOSAL The Maritime Administration's management approach is to remove all vessels that present the highest risk to the environment as soon as possible, and to have disposal alternatives and the necessary funding in place to ensure that obsolete vessels can be disposed of at a rate greater than obsolete vessels coming into the Maritime Administration's fleets. Ship disposal methods There are 4 methods for ship disposal. 1. Domestic Recycling Through ship sales offers and direct fee-for-service solicitation. The program awards ship recycling contracts to seven domestic ship recyclers. 2. Artificial Reefing The Maritime Administration accepts applications from coastal States, U.S. Territories and possessions and foreign governments for use of obsolete NDRF vessels as offshore reefs for the conse...
THE EFFECT OF ELECTRONIC MEDIA ON YOUNG PEOPLE Nowadays it is not a secret, that electronic media can be really harmful for developing human brain. But only some people know, how exactly TV, computer or radio influences younger generation. How to recognize whether the program is appropriate or not? The answer is pacing. If you see, that certain TV program is slow-paced and has the narrative form, then you should know that it can help to develop the long-term memory. But if the program is frenetically-paced, then it usually contains a violence that can inhibit the development of young people and also make children act impulsively and inappropriately. The violence on TV is the main issue that parents are worried about, as violence has a numbing effect on emotions. Moreover, young people can accept violence as the way of solving problems. I believe, that parents should properly control, what their...
PASCAL
1. loeng.
Looja - N. Wirth, nimi B. Pascali (1623-62) järgi.
+ Üldotstarbeline, hästi õpitav ja õpetatav, head stiili
õpetav, kergesti loetavad programmid.
Struktuurprogrammeerimise klassikaline keel.
- Standardis puuduvad madaltaseme vahendid jms. ->
suhteliselt aeglane programm, arvutist "viimast võtta"
on raske/võimatu.
Enamlevinud IBM PC-tüüpi arvuteil (Turbo Pascal, Object
Pascal (Delphi) jm), kuid ka UNIX ja VAX süsteemides.
SUN-i Pascal (meie töövahend) - üldiselt standard-Pascal.
Märkus edasijõudnutele.
moodulitehnika (UNIT) sellisel kujul ei tööta.
andmetüübid - standardsed + string ja alpha.
(string - 255 sümbolit, alpha - 10 sümbolit )
Üldised juhised:
·programm koosneb lausetest. Iga lause on soovitav kirjutada eraldi
reale, rea lõpus vajutada
Women's Learning Partnership for Rights, Development, and Peace. Liis Kivirand Backround Women's Learning Partnership (WLP) is an international non-profit, non-governmental organization. Dedicated to women's leadership and empowerment. Cooperation with 18 autonomous partner organizations in the Global South, particularly in Muslim-majority societies. WLP works to empower women to transform their families, communities, and societies. Primary objective is to increase the number of women taking on leadership and decision-making roles at family, community, and national levels, and to improve the effectiveness of feminist social movements in Muslim-majority societies and globally by strengthening the capacity of our partner organizations. Since its founding WLP has established a partnership model that allows for a geometric increase i...
Tallinn University of Technology Department of Electrical Engineering Report on laboratory work 3 on General Course of Electrical Drive SERVO DRIVE (FESTO) Jüri Lina 666BMW Group M16 Variant 2 Tallinn 2014 1. Functional Diagram Component list: PC with Wmmemoc software SEC-AC-305 controller MTR-AC-55 servo motor with encoder External 24VDC power supply unit Test stand with slide and limit switches 4. Tables of observations Task Operation/Record Observation 1 Measure the slide position at Limit Slide moved to the right, switch 1 Limit 1 reached at 1,46 2 Turn pot...
Kombinatsioonskeemid ja järjestiskeemid. Kõikides arvutites kasutatavad loogikaskeemid kuuluvad kahte suurde klassi. 3. võimalust ei ole. Kombinatsioonskeemid on sellised loogikaelementidest koostatud skeemid, millel ei ole mälu omadusi. Nad kirjelduvad loogikafunktsioonidega, milles ei ole aja parameetrit. Teades hetke sisendit, saame arvutada samal hetkel väljundite väärtused vastava loogikafunktsiooni abil. Ei ole oluline, millised olid sisendite väärtused varasematel hetkedel. Kui väljundeid on mitu, siis on iga väljundi jaoks eraldi funktsioon. Järjestikskeemid on sellised loogikaelementidest koostatud skeemid, millel on mälu omadused. See tähendab, et kõnealusel hetkel on väljundite väärtuste määramiseks vaja teada väljundite väärtusi ka eelnevatel hetkedel. Sel juhul sisaldab olek infot eelnevate hetkede väljundite väärtuste kohta. Sünkroonsel skeemil on spetsiaalne taktsisend, mis määrab üleminekuaja ühest olekust teise. As...
Tallinn University of Technology Department of Electrical Engineering Report on laboratory work 2 on General Course of Electrical Drive STEP DRIVE (FESTO) Jüri Lina 666BMW Group M16 Variant 2 Tallinn 2014 1. Functional Diagram 2. Program texts Program parts concenring the tasks of my variant are marked in bold, with an explanation of their meaning marked with // after them. Program 2: Velocity Profiles N000 G01 X180.13 FX20 N001 G01 X45.03 FX20 N002 G01 X180.13 FX50 // N002- Record number, G01- Move to position at specified speed, X180.13 - position parameter for X axis, FX50 -speed parameter for X axis. N003 G01 X45.03 FX50 N004 G01 X180.13 FX70 N005 G01 X45....
A B C D E F G H I 1 SureStep aggregate planning model 2 Suppose the company could begin 3 Input data training program to increase its wor 4 Initial inventory of shoes 500 5 Initial number of workers 100 program would result in the followin 6 Regular hours/worker/month 160 per pair of shoes over the next 4 m 7 Maximum overtime hours/worker/month 20 8 Hiring cost/worker $1 600 ...
tutvu lausearvutuse keskkonnaga: http://logik.phl.univie.ac.at/~chris/gateway/formular-uk-zentral.html Millistel muutuja väärtustel on lause (Av(B&A))v(-A&(Cv(B&-C))) väär? Panna tuleb results only, 0 on väär 1 on õige Tutvu ajalooga saidis kuni II maailmasõda: http://www.maxmon.com/history.htm Loe läbi jutt ja proovi andmetega mängida: http://math.hws.edu/TMCM/java/DataReps/index.html Kahend süsteemi arvu(101101001) ->kümnend süsteemiks. Nr sisse ja bianarile punkt, ja vaatan base ten integeri kümnendarvudest annab Ecki appletis juuresoleva graafilise kujutise, teen kujundi ja vaatan base integeri mis vastab kahendsüsteemi arvule 1110001 ASCII tabelis? Nr sisse ja punkt bianari, vaatan ...teksti Kümnendsüsteemi arv 33 on kahendsüsteemis? 33 kirjutan ja Base-ten integer, vaatan bianary Loe läbi jutud Atbashi ja Caesari šifri (Caesar cipher) kohta: http://www.wikipedia.org 2 Tutvu ajalooga kuni 1970ndad: http://www.islandnet.com/~...
Tallinna Teeninduskool Anna Popova Kodutöö 5 tärni hotellide võrdlus Õppeaine: Hotelli Majanduse Alused Õpetaja: Kris Leinatamm Tallinn 2013 Dubai Burj Al Arab Seda kirjeldatakse kui 7 tärni hotelli, kuna see on imeline koht igale maitsele. Hotell on ehitatud eraldi saarekesele, mis on maailma teine kõrguselt-321m, 60 korruse ja 202 magamistoaga. Ruumid asetsevad 2 korrusej ha on meeletult avarad. Selleks et broneerida endale tuba on sul vaja head reisiagenti, kuna läbi inretneti tee pole võimalik tuba broneerida Ultimate Rejuvenation Program Glowing Skin Programs Perfect Body Programs Eye-Lash Extensions Grooming for Hands and Feet Perfect Hands and Feet by La Ric Executive Manicure & Pedicure by La Ric Heavenly Hand And Foot Ritual by La Ric ...
A... AA Auto Answer AAA Authentication, Authorization and Accounting AAB All-to-All Broadcast AAC Advanced Audio Coding AACS Advanced Access Control System AAL Asynchronous Transfer Mode Adaption Layer AAM Automatic Acoustic Management AAP Applications Access Point [DEC] AARP AppleTalk Address Resolution Protocol AAS All-to-All Scatter AASP ASCII Asynchronous Support Package AAT Average Access Time AATP Authorized Academic Training Program [Microsoft] .ABA Address Book Archive (file name extension) [Palm] ABAP Advanced Business Application Programming [SAP] ABC * Atanasoff-Berry Computer (First digital calculating machine that used vacuum tubes) ABEND Abnormal End ABI Application Binary Interface ABIOS Advanced BIOS ABIST Automatic Built-In Self-Test [IBM] ABLE Adaptive Battery Life Extender + Agent Building and Learning Environment [IBM] ABM Asynchronous Balanc...
Bill Gates Bill Gates ● William Henry Gates III ● Born in 1955 ● 3 children and wife ● American investor, programmer, inventor and much more ● Chief executive and chairman of Mircrosoft ● Wealthiest overall from 1995 to 2009 – excluding 2008 Early life ● First computer when he was 13 ● Excused from math lessons ● First program - „tic-tac-toe“ ● Wrote his school a program that was able to schedule students ● Scored 1590 out of 1600 on the SAT reasoning test ● Moved to Harvard where he droped out Bill Gates ● Has written several books ● Several documentaries Triumph of the Nerds (1996) The Virtual Revolution (2010) ● „Largest“ person in computer science Famous quotes Used links ● http://i.imgur.com/FFmFzxJ.jpg ● http://www.smschacha.com/wp-content/uploads/201 2/06/business-quote-pics-bill-gate...
Bioinformaatika ülesanded Järjestuste paaride joondamine (dot-plot, dünaamiline programmeerimine, skoorid). 1. Milliste ülesannete lahendamisel on vajalik järjestuste joondamine? 2. Kasutada suvalist dot ploti visualiseerimise programmi (näiteks DotMatcher http://mfgn.usm.edu/cgi-bin/emboss.pl?_action=input&_app=dotmatcher või DotPlot'i applet http://arbl.cvmbs.colostate.edu/molkit/dnadot/index.html). Leida järgnevate nukleotiidsete järjestuste paaride sarnased piirkonnad erinevatel raami suurustel ja sarnasuse piirväärtustel raam = 1, lim = 0. Leida kõik suuremad sarnased piirkonnad varieerides raami ja piirväärtuse suurust, põhjendada tulemuste seost parameetrite väärtustega. Millise nähtusega võiks tegemist olla? · atgttgatgattaaaggaattatttttgatatggacggtgttttatttgatacagaacctttttatctgaggcg acgagaagatttttttaagacaaagggaattcccatt...
Valentina Tereskova Valentina Vladimirovna Tereshkova · Born: 6 March 1937 (age 81) · The first woman to go into space · Retired Russian cosmonaut, engineer, and politician · The only woman ever to have been on a solo space mission Valentina Tereshkova · June 16, 1963 · Vostok 6 · Time in space: 2 days, 23 hrs, and 12 mins · Orbited Earth 48 times in her space capsule · Only trip into space Before · Inspired by Gagarin · Volunteered for the Soviet space program · No experience as a pilot, but was accepted into the program because of her 126 parachute jumps. · 18 months of training · Of the five women, only Tereshkova went into space. After · Never flew in space again. · Later became a test pilot and instructor · Politician · Earned a doctorate in technical sciences. Honours and awards · Was honored with the title Hero of the Soviet Union. · She received the Order of Lenin · The Gol...
Object-oriented programming. Object-oriented programming (OOP) is a programming paradigm that uses "objects" and their interactions to design applications and computer programs. Programming techniques may include features such as information hiding, data abstraction, encapsulation, modularity, polymorphism, and inheritance. It was not commonly used in mainstream software application development until the early 1990s. Many modern programming languages now support OOP. Class Defines the abstract characteristics of a thing (object), including the thing's characteristics (its attributes, fields or properties) and the thing's behaviors (the things it can do, or methods, operations or features). One might say that a class is a blueprint or factory that describes the nature of something. For example, the class Dog would consist of traits shared by all dogs, such as breed and fur color (characteristics), and the abilit...
Kristina Raud YAGB-41 060290 10.04.07 Bioinformaatika ülesanded Fülogeneetilised puud. 1. DNA järjestuste fülogeneetiliste puude käsitsi koostamine kasutades kaugusmeetodeid (UPGMA, NJ). a. Moodustada antud 5 järjestuse kaugusmaatriks ning joonistada kvantitatiivne juurtega fülogeneetiline puu kasutades UPGMA meetodit. 1 ACAAACAGTT CGATCGATTT GCAGTCTGGG 2 ACAAACAGTT TCTAGCGATT GCAGTCAGGG 3 ACAGACAGTT CGATCGATTT GCAGTCTCGG 4 ACTGACAGTT CGATCGATTT GCAGTCAGAG 5 ATTGACAGTT CGATCGATTT GCAGTCAGGA Vastus: A B C D B 9 C 2 11 ...
Linux/ BSD OS sõnaraamat A Apache – Apache is a freely available Web server that is distributed under an "open source" license. Version 2.0 runs on most UNIX-based operating systems. - Tasuta kõigile kättesaadav veebiserver, 2.0 versioon jookseb enamustel UNIX'i põhistel OS'idel. Adaptive Server Enterprise (ASE) – Adaptive Server Enterprise (ASE) is a relational database management system ( RDBMS ) from Sybase, Inc. that runs on Linux and other Unix -based operating systems, Windows NT and Windows 2000 , and Mac OS. - Andmebaasi haldamissüsteem, mille lõi Sybase ettevõte. See jookseb kõigil Unixi põhistel- , Windows NT-, Windows 2000- ja Mac operatsioonisüsteemidel. B Bourne Again Shell (bash) – Bash (Bourne Again Shell) is the free version of the Bourne shell distributed with Linux and GNU operating systems. - Bourne shelli tasuta versioon Linuxile ja GNU-ga operatsioonisüsteemidele. Bash Cheat Sheets – Webpage...
Monument to the Conquerors of Space! Built in 1964 just at the entrance to the All-Russias evhibition, teh VDNKh, this is an extraordinary monument housing a full museum in the mound beneath. It is all clad in shiny stainless steel. In March 1958, a few months after the launch of Sputnik 1, a competition was announced for the best design of an obelisk celebrating the dawn of the Space Age. Out of some 350 proposals, the design by sculptor A.P. Faidysh-Krandievsky and architects A.N. Kolchin and M.O. Barshch was chosen. The grand opening of the monument took place on October 4, 1964, on the day of the 7th anniversary of the Sputnik 1 launch. Since the 1960s, this part of Moscow in general has had a high concentration of space- themed sights and names: besides the monument and the museum under it, the grand "Cosmos" pavilion in the Exhibition Centre displayed many artifacts of the Soviet space program. Many stre...
TALLINNA TEHNIKAÜLIKOOL INFOTEHNOLOOGIA TEADUSKOND Arvutitehnika instituut Süsteemitarkvara õppetool 121055IASB IAG0081 Programmeerimine I FUNKTSIOONI TABULLEERIMINE Kodutöö nr.1 Juhendaja: dotsent Vladimir Viies Margit Aarna Koostaja: Peeter Sikk Tallinn 2012 Autorideklaratsioon Kinnitan, et käesolev töö on minu töö tulemus ja seda ei ole minu ega kellegi teise poolt varem esitatud. Peeter Sikk 121055IASB Sisukord Ülesande püstitus................................................................................................................
The Ideal School for my children The ideal school for my children is an independent,nonprofit school that provides a comprehensive educational program for children of all abilities. The program would be designed to address each student's unique academic, social, and emotional needs while reinforcing individual strengths, interests, and abilities. Differentiated, individualized instruction is based on the learning style of each child. Most science classes would take place outdoors. Children would be exposed to great literature, art, and music and encouraged to make their own relationships with these works. Children would have guidance in setting long-and short-term goals. Teachers would serve as mentors and facilitators, sharing their educational passions and helping children learn to help themselves. The children would be completely free to set up their own schedules. However, they would be held accountable for achieving their goals ev...
Elva gümnaasiumi õpilastööde konkurss ,,Väärtused minu elus" VASTUTUSTUNNE/ KOHUSETUNNE Vastutustundlik inimene täidab talle pandud kohustusi eesmärgikindlalt ning teeb seda väärikalt. Vastutustunne on aja ja vahendite selline kasutamine, mis tooks maksimaalset kasu. Inimesed satuvad tänu erinevatele asjaoludele, vajadustele ja valikutele erinevatesse olukordadesse ja rollidesse. Moraalne vastutus on tunnustada nõudmisi, austada sulle antud rolli ja anda eesmärgi saavutamiseks oma parim. Isiklikku kohusetunnet tuleb elus tihti näidata nii tavalistes kui ka ootamatutes olukordades. Sotsiaalne ja globaalne vastutustunne hõlmab endas ka õiglust, inimlikkust ja inimõiguste austamist. Paljudele tundub vastutustunne koormav ning nad arvavad, et see ei käi nende kohta. Mugav on arvata, et ainult teistel on kohustused. Tavaliselt ...
Violence on television. In today's society television plays a big role. People watch TV for many different reasons. They watch TV mainly for entertainment, but they also watch it to learn and to find out news. Violence is a major problem, it has affected people for ages. Although violence on television is not the greatest thing, it should be not be banned. In my opinion TV can be very educationaland it shouldn't be banned. Most people watch TV to get away from reality. Watching shows that depict a fantasy world are a lot more interesting to watch. People don't want to see things that happen to them on a regular bases. TV can be educating. For example, there are countries that you haven't visited. Some shows take you right in the middle of it and you don't even have to walk. People also watch TV to find out news. It's much faster than the paper and the picture is moving. In one point of view TV c...
Read Chapter_5_Output_Control_Methods.pdf Question 1 (10 marks) Draw a PID control scheme and write down an equation to describe the PID control. Compare the differences between the “bang-bang“ control and proportional control. What are the functions of Integral and Derivative terms in the PID equation. Solution: Draw a PID control system: (Figure 5.5, page 111) Write down an equation to describe the PID control: (page 111) Compare the differences and the advantages between the “bang-bang“ control and Proportional control: (page 105) “Bang-Bang“ control or ON-OFF control is the simplest control system. It turns ON when the system needs more INPUT and tuns OFF if the system doesn’t need INPUT any more. The INPUT is similar to the PWM square wave (running ON and OFF during the length of the needed INPUT). Bang-Bang control is similar to the PWM input signal Proportional control: Bang-Bang con...
Words that ADD information · also · and · another · besides first, second, third, ... · furthermore · in addition · moreover The little girl put on her yellow shirt and brown overalls. Chris is on the basketball team this semester at Indiana School for the Deaf. In addition, he is on the soccer team. We will be here for one more week so we can finish up our work. Another reason we are staying longer is because we do not want to miss the Deaf Way conference. First of all, pour a half-cup of milk in the bowl; second, add two eggs; and third, stir the mixture. I admire I. King Jordan because he is the first deaf president of Gallaudet. Besides that, I admire him because he is a great long distance runner. Furthermore, he is a dedicated family man. All in all, there ís not much to dislike about the man, except he is too perfect! Crystal likes camping in the mountains. Also, Crystal is an experienced hiker. Texas Schoo...
Aristoteles (470-399 e.m.a) : väidete struktuur kui iseseisev uurimisobjekt 1967- IBM builds the first floppy disk Süllogism (Aristoteles): 1967 - Seymour Papert designed LOGO as a computer language for children. 1. eeldus: iga x on y. 1968 - Robert Noyce and Gordon Moore found Intel Corporation 2. eeldus: mõni z on x. 1968 - Douglas C. Engelbart, of the Stanford Research Institute, demonstrates järeldus: mõni z on y. his system of keyboard, keypad, mouse, and windows at the Joint Computer Iga b on a Conference in San Francisco's Civic Center. He demonstrates use of a word Mitte ükski b pole a ...
Operatsioonisüsteemi alused · http://codex.cs.yale.edu/avi/os-book/ · http://physinfo.ulb.ac.be/cit_courseware/cscourse.htm · http://www.cs.ut.ee/~varmo/OS2004/slides/ Referaat · Tähtaeg 1. Mai · Teema kooskõlastada õpetajaga · Laadida üles õpetaja serverisse hot.ee/llesurk · Edasi E-õpe · Registreerida ennast keskkonda · E-mail õpetajale · Õpetaja kinnistab teid õigele kursusele · Parooli mitte unustada (küsige e-maili teel õpetajalt) Mõiste Operatsioonisüsteem (OS) see on süsteemi- ja juhtprogrammide kompleks ja ettenähtud arvutisüsteemi ressursside efektiivseks kasutamiseks. See on vahendaja arvutikasutaja ja arvuti (riistvara) vahel programm, mis vahetult suhtleb riistvaraga ning töötab temaga ühtse tervikuna. Peab võimaldama täita arvutiprogramme, mugaval efektiivsel viisil. Opsüsteemi peab tagama arvutisüsteemi korrektse käitumise. Operatsioonisüsteem, O...
TALLINN COLLEGE OF ENGINEERING INGLISE KEEL Essee Differences between Estonian and USA school and education systems. Juhendaja: Koostanud: 2009 Differences between Estonian and USA school and education systems. Question is, how different are our own and this big country they call United States of America's education. Or maybe there is no difference at all, and our systems about school and education are more similar than they appear at first sight. After reading all the materials and all sorts of notes about USA's education systems and their school household. All at once I realized, that they are not so different at all. Like for example USA's kids have to go to school exactly the same amount of time as our Estonian children. And basically learn same amount of same things. Like everywhere there are always ...
Erialane inglisekeel 2 semester. Software engineering Tarkvara tehnika. Sub.discliplines of software engineering. 1. Software requirements 2. Software design 3. Software develompment 4. Software testing 5. Software maintenance 6. Software configuration managment 7. Software engineering managment 8. Software development process 9. Software qengineering tools 10. Software quality Ex 1 1. analysing and defining the problem to be solved. 2. Desiging the program. 3. Coding. 4. Testing. 5. Training the users. 6. Dockumenting. 7. Obtaining feedback from user UML- united modeling language Algoritm- eeskiri mis tleb kuidas seda prorgammi kirjutada. Teine tund. protsessori- keskmine keel on assemble languages. Interpreted languages- tlgendamine. Declarated languages- kirjeldatakse programmi omadusi. Object- oriented class- based languages 1) multiple di...
Britta Kase 143123HAKB Summary The booklet offers a brief, simple explanation how the European Union is relevant to us in our everyday life, how it affects our lives in many areas and how can we benefit from it. The booklet gives also a very readable overview of EU’s history and how its member states have come together. It’s a great starting point to know the roots, history and functioning of the European Union. I found this booklet interesting because it provides an insight into relevance of the EU. I have never thought that making phone calls and flying has become cheaper as a result of EU. EU has abolished national monopolies and has permitted competition. For me the most important thing is air, water and food quality. The EU has introduced c...
. , , /, * ( 75%, 1) . . . () * ( , , 95%) 2) .. . ) * ( 8090%), ( ). * () * 3) .. . . (, * () 2 !!! ..) , , . ...
using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace Ruutv6rrand { class Program { static void Main(string[] args) { int a, b, c, D; double X1, X2; Console.WriteLine("Palun sisesta a vrtus:"); a = Convert.ToInt32(Console.ReadLine()); if (a == 0) Console.Beep(); Console.WriteLine("Antud tehe ei ole ruutvrrand, kuna a vrdub nulliga."); if (a != 0) Console.WriteLine("Palun sisesta b vrtus:"); b = Convert.ToInt32(Console.ReadLine()); Console.WriteLine("Palun sisesta c vrtus:"); c = Convert.ToInt32(Console.ReadLine()); D = b * b - 4 * a * c; if (D >= 0) { X1 = (-b + Math.Sqrt(D)) / (2 * a); X2 = (-b - Math.Sqrt(D)) / (2 * a); ...
The Gemini Guidance Computer XXX The Gemini Guidance computer - Citations http://history.nasa.gov/computers/ch1-1.html Retrieved 24 Novmber 2015 https://en.wikipedia.org/wiki/Gemini_Guidance_Computer Retrieved 24 November 2015 The Gemini Guidance computer - Vocabulary The Gemini Guidance computer - Structure History Objective Functions The Gemini Guidance computer - History End of the Mercury program 1. Man in space New era of testing 2 men in space more instrumentation Introduced in 1965 The Gemini Guidance computer - Objective To maneuver the spacecraft in space Calculate the distances between the rendezvous points Practicing rendezvous with Agena. The Gemini Guidance computer - Functions Prelaunch Ascent backup Insertion Catch-up Rendezvous Re-entry The Gemini Guidance computer - Conclusion 1. History 2. Objective 3. Function
TENNIS Katriin Mering 11B ABOUT Between two players (singles) Between two teams of two players each (doubles) Racket Send the ball through the opponent's racket side Ball diameter is 6.35cm to 6.67cm and weighs 57-59 grams Court length is 23.77m and a width is 8.23m for singlegame and 10.97m for doublegame. Racket can't be longer than 81.28cm or greater than 31.75cm. Adult racket weighs 300-325 grams. 15, 30, 40 and the fourth point bring victory The player (or couple) who wins six games, wins set HISTORY Originated in France in the 12th century Patented by major Walter Clopton Wingfield Program of the Olympic tennis was the from 1896 to 1924 thank you for listening! Mainor Business School 20.12.10
The value of things VS the price of things A value can be much more than simple numbers, a value can show what memories, connections and contact people have with a thing. But what exactly is a thing? Well a thing is something lifeless, an item for a certain purpose, it’s something for certain use. When we take a look at the word named „price“, what does it mean? A price usually is seen as a number, as how much something costs. Things can be „overpriced“, but never „overvalued“. An item of high value could have no price, but at the same time an high priced item, could have no value. It’s this way because people see differently, people have different memories and emotions to remember. But as in this world today, price matters. People can’t afford anything, price means something as well, it can show how wealthy you are, how much someone can mean to you. Price is just a number, it shows how much something pays...
Diagnostika vahendid Kirjeldage interneti põhjal 1. 3 tarkvaralist võrgu monitooringu vahendit: Mille abil saab hoia pilk peal võrgu liiklusel? PRTG Network Monitor - PRTG Network Monitor includes more than 50 sensor types for all common network services (e.g. PING, HTTP, SMTP, POP3, FTP, etc.), allowing to monitor your network systems for speed and failures. As soon as outages occur the software will alert you by sending emails, SMS, pager messages and other notifications. Request times and downtimes are constantly recorded in the database and you can compile performance, downtime and SLA reports at any given time. NetCrunch 6 - AdRem NetCrunch 6 is a Network Monitoring Software for diverse network environments. It can be configured remotely using Administration Console. Highly optimized remote access protocol (with encryption and compression) gives to ...
UNDERSTANDING HEALTH CHAPTER 6.NUTRITION AND WEIGHT CONTROL WILLIAM M. KANE Introduction ◦ Name: Mairis Õispuu ◦ Studying: Food Engineering and Product Development ◦ Topic: Nutrition and Weight Control ◦ Importance of this topic Section 1. The Basics of Nutrition ◦ Carbohydrates ◦ Fats ◦ Proteins ◦ Vitamins ◦ Minerals ◦ Water ◦ Fibre Section 2. A Balanced Diet ◦ The Food Groups ◦ Milk and milk products ◦ Fruits and vegetables ◦ Breads and cereals ◦ Sugar, refined fats, and oils ◦ Meat group ◦ Vegetarianism ◦ Dietary Guidelines Section 3. Weight Problems ◦ What is the right weight for you? ◦ Body composition ◦ Two types of obesity ◦ Causes of weight problems ◦ Psychological reasons of eating ◦ Lack of exercise ◦ Speed of eating ◦ Junk food Section 4. Methods of Weight Control ◦ Planning a weight-control program ◦ The need of exercise ◦ Changing your eating habits ◦ Fad diets ◦ Sweating ◦ Commercial ...
Turingi masin 1937 Universaalne masin suudab arvutada/järeldada kõike Turingi tees: kõike mida saab üldse mingi masinaga järeldada/arvutada, saab ka Turingi masinaga arvutada Parmenides (5 saj. e.m.a) kasutas pikki loogilisi põhjendusi. Zenon Elast (5 saj e.ma) paradoksid Sofistid-Sokrates (470-399 e.m.a), Platon (428/427 - 348/347e.m.a) Aristoteles: väidete struktuur kui iseseisev uurimisobjekt Süllogismi näited:1eeldus:iga koer on imetaja, 2eeldus mõned neljajalgsed on koerad, järeldus: mõned neljajalgsed on imetajad. Süllogism on väitlus, kus mingitest etteantud väidetest järeldub paratamatult uus väide. Aristotelese puhul alati kaks kategoorilist eeldust, üks kategooriline järeldus Stoikud uurisid, kuidas saab loogiliste sidesõnade (ja, ei, või, kui ...siis)abil lihtsamatest lausetest keerulisemaid kokku panna ja kuidas näidata selliselt moodustatud lausete õigsust. Ramon Llull 1235- 1315 müstik Peateos Ars magna, generalis et ultim...
Rahvusvahelised organisatsioonid Karina Romanova 2013.a Amisom Eesmärgid Tagada riigis julgeolek Tekitada turvaline keskkond OCHA (Humanitaarasjade koordineerimisbüroo) Levindada inimkannatusi kriisides ja hädaolukordades Seista inimõiguste eest Edendada ennetustöid ja valmisolekut Oxfam Tagada võimalus kasutada põhiteenused (nt.haridus, meditsiin) Toetada rahvusvaheline võrdne kaubandus UNHCR seista pagula...
Types of Verbs Group I Normal Verbs Most verbs are "Normal Verbs." These verbs are usually physical actions which you can see somebody doing. These verbs can be used in all tenses. Normal Verbs to run, to walk, to eat, to fly, to go, to say, to touch, etc. Examples: · I eat dinner every day. · I am eating dinner now. Group II Non-Continuous Verbs The second group, called "Non-Continuous Verbs," is smaller. These verbs are usually things you cannot see somebody doing. These verbs are rarely used in continuous tenses. They include: Abstract Verbs to be, to want, to cost, to seem, to need, to care, to contain, to owe, to exist... Possession Verbs to possess, to own, to belong... Emotion Verbs to like, to love, to hate, to dislike, to fear, to envy, to mind... Examples: · He is needing help now. Not Correct · He needs help now. Correct · He is wanting a drink now. Not Correct ...
annaabi.ee 
Sisene Facebook'ga
Sisene Google'ga
Sisene LinkedIn'ga
